Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU037461

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Bcl2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CTGCAAATGCTGGACTGAAAAATTGTAATTCATCTGCCGCCGCCGCCGCTGCCTTTTTGCCCCGCTGCGGTGCTCTTGAGATCTCTGGTTGGGATTCCTACGGATTGACATTCTCAGTGAAGCCGGAGTGTGAGGACCCAATCTGGAAACCCTCCTGATTTTTCCTCCACCTAGCCCCCAGACCCCAACTCCCGATTCATTGCAAGTTGTAAAGAAGCTTATACAAGGAGACTTCTGAAGATCGATGGTGTGGTTGCCTTATGTATTTGTTTGGGTTTTACCAAAAAAGGGTAAACTTGACAGAAGATCATGCCGTCCTTAGAAAATACAGCATTGCGGAGGAAGTAGACTGATATTAACAAAGCTTAATAAATAATGTACCTCATGAAATAAAAAGCAGAAAGGAATTTGAATAAAAATTTCCTGCATCTCATGCCAACGGGGAAACACCAGAATCAAGTGTTCGGTGTAACTAAAGACACCCCTTCATCCAAGAA

N° accesso Ensembl | topo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Xi-Mei Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(5), 1914-1926 (2015-11-20)
Dipeptidyl peptidase-4 (DPP-4) inhibitors have pleiotropic effects on cardiovascular protection beyond the antidiabetic property. However, it remains unknown that the impact of one DPP-4 inhibitor sitagliptin on the survival of mesenchymal stem cells (MSCs) in hypoxia and serum deprivation (H/SD)
Qingmin Wang et al.
PloS one, 9(7), e100949-e100949 (2014-07-08)
MPT64 is one of the secreted proteins from Mycobacterium tuberculosis. Little is known about its role in infection by Mycobacterium tuberculosis. In this study, we demonstrated that MPT64 could dose-dependently inhibit the apoptosis of RAW264.7 macrophages induced by PPD-BCG. Quantitative
Yuting Wen et al.
Science advances, 6(31), eabc2148-eabc2148 (2020-08-25)
It requires multistep synthesis and conjugation processes to incorporate multifunctionalities into a polyplex gene vehicle to overcome numerous hurdles during gene delivery. Here, we describe a supramolecular platform to precisely control, screen, and optimize molecular architectures of siRNA targeted delivery
Yang Zhou et al.
Journal of cell science, 127(Pt 20), 4494-4506 (2014-08-12)
Tubular epithelial cell apoptosis contributes to tubulointerstitial fibrosis but its regulation remains unclear. Here, in fibrotic kidney induced by unilateral ureteral obstruction (UUO), we demonstrate that miR-34a is markedly upregulated in tubulointerstitial spaces and microvesicles isolated from obstructed kidney. However
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.