Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EMU013051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cav1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CATCAGCACGCAGAAAGAGATATGAGGGACATTTCAAGGATGAAAGGTTTTTTCCCCCCTTACTATTTCCTTGGTGCCAATTCCAAGTTGCTCTCGCAGCAGCAAATTTATGAATGGTTTGTCTTGATCAAGAACAAAGAATTCATTCCCACCATTCTCATATATACTACTTGTCTCTTCTAAGCTACTGCATCTATGTTTGACAGTCTGGAATGTTTAAACCCATTCCTGCTCTCTCTTTTATATGTGAATCATTGTTTCATTGGCTAAAATATAAACATATTGTTGAAAGATGATTTGAGAAAAATAGGAAGGACTGGGAGGCAGGGAAGAGTACCAACAACCTCAACTGCCTACTCAAAGGTGATGATGTCATACAAAGGGAAGAGATTCAGGTTACGGCCATTTGTTTAGGGGCATGAAGG

N° accesso Ensembl | topo

ENSMUSG00000007655

N° accesso NCBI

NP_031642

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

mouse ... CAV1(12389) , Cav1(12389)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Emily J Guggenheim et al.
Nanotoxicology, 14(4), 504-532 (2020-02-11)
Engineered Nanomaterials (NMs), such as Superparamagnetic Iron Oxide Nanoparticles (SPIONs), offer significant benefits in a wide range of applications, including cancer diagnostic and therapeutic strategies. However, the use of NMs in biomedicine raises safety concerns due to lack of knowledge
Fanrui Meng et al.
PloS one, 10(5), e0126056-e0126056 (2015-05-06)
Expression of Caveolin-1 (Cav1), a key component of cell surface caveolae, is elevated in prostate cancer (PCa) and associated with PCa metastasis and a poor prognosis for PCa patients. Polymerase I and Transcript Release Factor (PTRF)/cavin-1 is a cytoplasmic protein
Carmen Juks et al.
Biochimica et biophysica acta, 1848(12), 3205-3216 (2015-09-27)
Cell penetrating peptides are efficient tools to deliver various bioactive cargos into cells, but their exact functioning mechanism is still debated. Recently, we showed that a delivery peptide PepFect14 condenses oligonucleotides (ON) into negatively charged nanocomplexes that are taken up
Jing Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(4), 1289-1300 (2015-10-03)
Pulmonary microvascular endothelial cell (PMVEC) proliferation and angiogenesis contribute to the development of hepatopulmonary syndrome (HPS). MicroRNA-199a-5p (miR-199a-5p) has emerged as a potent regulator of angiogenesis, and its expression levels significantly decrease in the serum of patients with hepatopathy. However
Q Chen et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(2), 33-38 (2015-05-31)
Bladder cancer occurs in the majority of cases in males, which represents the fourth highest incident cancer in men and tenth in women. It is associated with a high rate of recurrence, and prognosis is poor once the cancer metastasizes
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.