Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

EHU131771

Sigma-Aldrich

MISSION® esiRNA

targeting human HAS2

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTTGGGTGTGTTCAGTGCATTAGTGGACCTCTGGGAATGTACAGAAACTCCTTGTTGCATGAGTTTGTGGAAGATTGGTACAATCAAGAATTTATGGGCAACCAATGTAGCTTTGGTGATGACAGGCATCTCACGAACCGGGTGCTGAGCCTGGGCTATGCAACAAAATACACAGCTCGATCTAAGTGCCTTACTGAAACACCTATAGAATATCTCAGATGGCTAAACCAGCAGACCCGTTGGAGCAAGTCCTACTTCCGAGAATGGCTGTACAATGCAATGTGGTTTCACAAACATCACTTGTGGATGACCTACGAAGCGATTATCACTGGATTCTTTCCTTTCTTTCTCATTGCCACAGTAATCCAGCTCTTCTACCGGGGTAAAATTTGGAACATTCTCCTCTTCTTGTTAACTGTCCAGCTAGTAGGTCTCATAAAATCATCTTTTGCCAGCTGCCTTA

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hong Zhan et al.
Fertility and sterility, 114(4), 888-898 (2020-08-09)
To investigate the role(s) of hyaluronan synthase 2 (HAS2) and hyaluronan in disease progression of endometriosis and epidermal growth factor (EGF)-induced motility changes of endometriotic cells. A case-control experimental study and in vitro primary cell culture study. University hospital-affiliated research centers.
Xiaoyan Chen et al.
Cell communication and signaling : CCS, 18(1), 89-89 (2020-06-11)
Hyaluronan (HA) is an abundant component of the bone marrow (BM) extracellular matrix. Here, we investigated the abnormal deposition of HA in the BM microenvironment and its remodelling in mediating the malignancy of breast cancer cells (BCCs). BCCs were transplanted
Douglas Hanniford et al.
Cancer cell, 37(1), 55-70 (2020-01-15)
Metastasis is the primary cause of death of cancer patients. Dissecting mechanisms governing metastatic spread may uncover important tumor biology and/or yield promising therapeutic insights. Here, we investigated the role of circular RNAs (circRNA) in metastasis, using melanoma as a
Priscilla Soulié et al.
American journal of physiology. Cell physiology, 307(8), C745-C759 (2014-08-29)
Generation of branched tubes from an epithelial bud is a fundamental process in development. We hypothesized that induction of hyaluronan synthase (Has) and production of hyaluronan (HA) drives tubulogenesis in response to morphogenetic cytokines. Treatment of J3B1A mammary cells with

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.