Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU115561

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM6A (1)

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CGTGTCGTATCAGCAGGAAATCTTCTAAGCCATGTTGGTCATACCATATTGGGCATGAACACAGTTCAACTATACATGAAAGTTCCAGGGAGCAGAACACCAGGTCATCAGGAAAATAACAACTTCTGTTCAGTTAACATAAATATTGGCCCAGGTGACTGTGAATGGTTTGTTGTTCCTGAAGGTTACTGGGGTGTTCTGAATGACTTCTGTGAAAAAAATAATTTGAATTTCCTAATGGGTTCTTGGTGGCCCAATCTTGAAGATCTTTATGAAGCAAATGTTCCAGTGTATAGGTTTATTCAGCGACCTGGAGATTTGGTCTGGATAAATGCAGGCACTGTTCATTGGGTTCAGGCTATTGGCTGGTGCAACAACATTGCTTGGAATGTTGGTCCACT

N° accesso Ensembl | uomo

ENSG00000147050

N° accesso NCBI

NM_021140

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... KDM6A(7403) , UTX(7404)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Hongya Han et al.
PloS one, 9(1), e85085-e85085 (2014-01-28)
Arachidonate 15-lipoxygenase-1 (ALOX15) oxygenates polyunsaturated fatty acids and bio-membranes, generating multiple lipid signalling mediators involved in inflammation. Several lines of evidence indicate that ALOX15 activation in the respiratory tract contributes to asthma progression. Recent experimental data reveals that histone modification
Hiroyuki Imuta et al.
Heart and vessels, 35(12), 1746-1754 (2020-07-18)
Macrophages play a crucial role in the development of atherosclerosis. To explore the mechanism by which macrophages attain a proinflammatory phenotype for a sustained period, we stimulated macrophages with lipopolysaccharide (LPS) and interferon-γ (IFN-γ) and measured the interleukin-1β (IL-1β) expression.
Shayesta Seenundun et al.
The EMBO journal, 29(8), 1401-1411 (2010-03-20)
Polycomb (PcG) and Trithorax (TrxG) group proteins act antagonistically to establish tissue-specific patterns of gene expression. The PcG protein Ezh2 facilitates repression by catalysing histone H3-Lys27 trimethylation (H3K27me3). For expression, H3K27me3 marks are removed and replaced by TrxG protein catalysed
Rintaro Hashizume et al.
Nature medicine, 20(12), 1394-1396 (2014-11-18)
Pediatric brainstem gliomas often harbor oncogenic K27M mutation of histone H3.3. Here we show that GSKJ4 pharmacologic inhibition of K27 demethylase JMJD3 increases cellular H3K27 methylation in K27M tumor cells and demonstrate potent antitumor activity both in vitro against K27M
Rakel Brendsdal Forthun et al.
PloS one, 7(11), e48992-e48992 (2012-11-17)
The mechanisms of successful epigenetic reprogramming in cancer are not well characterized as they involve coordinated removal of repressive marks and deposition of activating marks by a large number of histone and DNA modification enzymes. Here, we have used a
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.