Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU093841

Sigma-Aldrich

MISSION® esiRNA

targeting human RORC

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GAGGAAGTCCATGTGGGAGATGTGGGAACGGTGTGCCCACCACCTCACCGAGGCCATTCAGTACGTGGTGGAGTTCGCCAAGAGGCTCTCAGGCTTTATGGAGCTCTGCCAGAATGACCAGATTGTGCTTCTCAAAGCAGGAGCAATGGAAGTGGTGCTGGTTAGGATGTGCCGGGCCTACAATGCTGACAACCGCACGGTCTTTTTTGAAGGCAAATACGGTGGCATGGAGCTGTTCCGAGCCTTGGGCTGCAGCGAGCTCATCAGCTCCATCTTTGACTTCTCCCACTCCCTAAGTGCCTTGCACTTTTCCGAGGATGAGATTGCCCTCTACACAGCCCTTGTTCTCATCAATGCCCATCGGCCAGGGCTCCAAGAGAAAAGGAAAGTAGAACAGCTGCAGTACAATCTGGAGCTGGCCTT

N° accesso Ensembl | uomo

ENSG00000143365

N° accesso NCBI

NM_001001523

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... RORC(6097) , RORC(6097)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Geyang Xu et al.
Molecular and cellular endocrinology, 416, 9-18 (2015-08-19)
Glucagon-like peptide (GLP-1), an intestinal incretin produced in L-cells and released in response to meal intake, functions to promote insulin secretion and to decrease plasma glucose. Ghrelin is an orexigenic hormone critical for glucose homeostasis. The molecular mechanism by which
Yun-Jeong Jeong et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 68, 218-225 (2014-03-29)
Bee venom is a natural compound produced by the honey bee (Apis mellifera), and has been reported as having the biological and pharmacological activities, including anti-bacterial, anti-viral and anti-inflammation. In the present study, the inhibitory effects of bee venom and
Hong Zhang et al.
International journal of molecular sciences, 19(4) (2018-04-05)
20(S)-Protopanaxadiol (PPD) is one of the major active metabolites of ginseng. It has been reported that 20(S)-PPD shows a broad spectrum of antitumor effects. Our research study aims were to investigate whether apoptosis of human breast cancer MCF-7 cells could
Jia-Hui Rong et al.
OncoTargets and therapy, 14, 289-300 (2021-01-21)
In recent years, radioactive 125I seed implantation combined with chemotherapy has been regarded as a safe and effective treatment for advanced non-small cell lung cancer (NSCLC). However, the mechanism underlying this success is still unclear. In this study, we investigated
Nishant S Gandhi et al.
Pharmaceutical research, 35(10), 188-188 (2018-08-15)
Lung cancer is one of the leading causes of deaths in the United States, but currently available therapies for lung cancer are associated with reduced efficacy and adverse side effects. Small interfering RNA (siRNA) can knock down the expression of
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.