Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU018981

Sigma-Aldrich

MISSION® esiRNA

targeting human RAB11A

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TTGCAACAAGAAGCATCCAGGTTGATGGAAAAACAATAAAGGCACAGATATGGGACACAGCAGGGCAAGAGCGATATCGAGCTATAACATCAGCATATTATCGTGGAGCTGTAGGTGCCTTATTGGTTTATGACATTGCTAAACATCTCACATATGAAAATGTAGAGCGATGGCTGAAAGAACTGAGAGATCATGCTGATAGTAACATTGTTATCATGCTTGTGGGCAATAAGAGTGATCTACGTCATCTCAGGGCAGTTCCTACAGATGAAGCAAGAGCTTTTGCAGAAAAGAATGGTTTGTCATTCATTGAAACTTCGGCCCTAGACTCTACAAATGTAGAAGCTGCTTTTCAGACAATTTTAACAGAGATTTACCGCATTGTTTCTCAGAAGCAAATGTCAGACAGACGCGAAAATGACATG

N° accesso Ensembl | uomo

ENSG00000103769

N° accesso NCBI

NM_004663

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... RAB11A(8766) , RAB11A(8766)

Categorie correlate

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Danyi Zhao et al.
Acta biochimica Polonica, 67(4), 531-538 (2020-12-17)
Esophageal cancer (EC) recently has become a common malignancy of digestive system worldwide. RAB11A is a critical member of the small GTPases superfamily and was reported to affect a variety of cellular functions. However, its potential effects on EC progression
Yunxia Zhang et al.
Cancer cell international, 20(1), 571-571 (2020-12-10)
Prostate cancer (PC) is common male cancer with high mortality worldwide. Emerging evidence demonstrated that long noncoding RNAs (lncRNAs) play critical roles in various type of cancers including PC by serving as competing endogenous RNAs (ceRNAs) to modulate microRNAs (miRNAs).
Li Zhong et al.
Signal transduction and targeted therapy, 6(1), 59-59 (2021-02-12)
It remains unknown for decades how some of the therapeutic fusion proteins positive in a small percentage of cancer cells account for patient outcome. Here, we report that osteosarcoma Rab22a-NeoF1 fusion protein, together with its binding partner PYK2, is sorted
Liane Rauch et al.
Traffic (Copenhagen, Denmark), 15(10), 1083-1098 (2014-07-22)
Bacteria that invade human endothelial cells can be efficiently eliminated in phagolysosomes. We investigated the role of vesicle tethering exocyst complex in maturation and function of endothelial cell phagosomes harbouring staphylococci or latex beads. Exocyst complex proteins (Sec5, -8, -10
Ola Sabet et al.
Nature communications, 6, 8047-8047 (2015-08-22)
Autocatalytic phosphorylation of receptor tyrosine kinases (RTKs) enables diverse, context-dependent responses to extracellular signals but comes at the price of autonomous, ligand-independent activation. Using a conformational biosensor that reports on the kinase activity of the cell guidance ephrin receptor type-A

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.