Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU063881

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pecam1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAGGAGTCCTTCTCCACTCCCAAGTTTGAAATCAAGCCCCCTGGGATGATCATAGAAGGGGACCAGCTGCACATTAGGTGCATAGTTCAAGTGACACACTTGGTCCAGGAGTTTACAGAAATTATCATCCAAAAAGACAAGGCGATTGTAGCCACCTCCAAGCAAAGCAGTGAAGCTGTCTACTCAGTCATGGCCATGGTCGAGTACAGTGGACACTACACCTGCAAAGTGGAATCAAACCGTATCTCCAAAGCCAGTAGCATCATGGTCAACATAACAGAGCTGTTTCCCAAGCCGAAGTTAGAGTTCTCCTCCAGTCGTCTGGACCAAGGGGAGTTGTTGGACCTGTCCTGCTCCGTCTCGGGCACACCTGTAGCCAACTTCACCATCCAGAAGGAAGAGACGG

Numéro d'accès Ensembl | souris

ENSMUSG00000020717

Numéro d'accès NCBI

NM_008816

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... PECAM1(18613) , Pecam1(18613)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Masayasu Hara et al.
Anticancer research, 36(1), 169-177 (2016-01-02)
We evaluated the ability of itraconazole to enhance the effects of bevacizumab in bevacizumab-resistant cancer cells, endothelial cells, and cancer-associated fibroblasts (CAFs). Human gastrointestinal cancer cell lines (HT-29, MKN-28 and MKN-45), human umbilical vein endothelial cells (HUVECs), and CAFs established
Larissa Pfisterer et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 28(8), 3518-3527 (2014-04-29)
Despite the high prevalence of venous diseases that are associated with and based on the structural reorganization of the venous vessel wall, not much is known about their mechanistic causes. In this context, we demonstrated that the quantity of myocardin
Caroline Arnold et al.
EMBO molecular medicine, 6(8), 1075-1089 (2014-06-29)
Arteriogenesis-the growth of collateral arterioles-partially compensates for the progressive occlusion of large conductance arteries as it may occur as a consequence of coronary, cerebral or peripheral artery disease. Despite being clinically highly relevant, mechanisms driving this process remain elusive. In
James Shue-Min Yeh et al.
PloS one, 10(7), e0129681-e0129681 (2015-07-15)
Microbubbles conjugated with targeting ligands are used as contrast agents for ultrasound molecular imaging. However, they often contain immunogenic (strept)avidin, which impedes application in humans. Although targeting bubbles not employing the biotin-(strept)avidin conjugation chemistry have been explored, only a few
Yang Kyung Cho et al.
Cornea, 33(6), 621-627 (2014-04-15)
Dry eye disease is becoming recognized as an immune-inflammation mediated disorder. Surgical insults such as corneal incision or suture can aggravate dry eye. We sought to determine whether underlying dry eye aggravates corneal inflammatory infiltration, hemangiogenesis, and lymphangiogenesis (LY) induced
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique