Accéder au contenu
Merck
Toutes les photos(1)

Documents

EMU031691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Casp8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAAATGAAATCCACGAGATTCTAGAAGGCTACCAAAGCGCAGACCACAAGAACAAAGACTGCTTCATCTGCTGTATCCTATCCCACGGTGACAAGGGTGTCGTCTATGGAACGGATGGGAAGGAGGCCTCCATCTATGACCTGACATCTTACTTCACTGGTTCAAAGTGCCCTTCCCTGTCTGGGAAACCCAAGATCTTTTTCATTCAGGCTTGCCAAGGAAGTAACTTCCAGAAAGGAGTGCCTGATGAGGCAGGCTTCGAGCAACAGAACCACACTTTAGAAGTGGATTCATCATCTCACAAGAACTATATTCCGGATGAGGCAGACTTTCTGCTGGGAATGGCTACGGTGAAGAACTGCGTTTCCTACCGAGATCCTGTGAATGGAACCTGGTATATTCAGTCACTTTGCCAGAGCCTGAGGGAAAGATGTCCTCAAGGAGATGACATTCTTAGCATCCTGACTGGCGT

Numéro d'accès Ensembl | souris

ENSMUSG00000026029

Numéro d'accès NCBI

NM_009812

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CASP8(12370) , Casp8(12370)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

R Coriat et al.
Cell death & disease, 2, e191-e191 (2011-08-13)
Organotellurides are newly described redox-catalyst molecules with original pro-oxidative properties. We have investigated the in vitro and in vivo antitumoral effects of the organotelluride catalyst LAB027 in a mouse model of colon cancer and determined its profile of toxicity in
René Weiss et al.
Antiviral research, 123, 93-104 (2015-09-15)
New anti-viral agents and strategies are urgently needed to fight rapidly mutating viruses, as vaccine programs cannot react fast enough to prevent pandemics. Recently, we have shown that interleukin-24 (IL-24) sensitizes tumor cells to toll-like receptor 3 (TLR3) mediated apoptosis.
Meng Yu et al.
Molecular carcinogenesis, 53(7), 505-513 (2013-01-30)
Activation of telomerase is a key element in oncogenesis and resistance to apoptosis for many cancers. Some histone deacetylase inhibitors (HDACi) or chemotheraputic agents have been reported to downregulate the expression of human telomerase reverse transcriptase (hTERT). However, whether hTERT
Kei-Ichi Ishikawa et al.
PloS one, 9(4), e94645-e94645 (2014-04-12)
Mutations in p150glued cause hereditary motor neuropathy with vocal cord paralysis (HMN7B) and Perry syndrome (PS). Here we show that both overexpression of p150glued mutants and knockdown of endogenous p150glued induce apoptosis. Overexpression of a p150glued plasmid containing either a

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique