Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EMU014751

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Eif2ak3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGATCAAATGGAAGCCCTTAATCCATTCTCCTTCTAGGACTCCTGTCTTGGTTGGGTCTGATGAATTTGACAAATGTCTAAGTAATGATAAGTATTCCCACGAAGAATACAGTAATGGTGCACTTTCAATCCTCCAGTATCCATACGATAACGGTTACTATCTGCCATACTACAAGAGAGAAAGGAATAAGCGGAGCACGCAGATCACAGTCAGGTTCCTGGACAGCCCCCACTACAGCAAGAACATCCGCAAGAAGGACCCTATCCTCCTGCTGCACTGGTGGAAGGAGATATTCGGGACGATCCTGCTTTGCATCGTAGCCACGACCTTCATCGTGCGCAGGCTTTTCCATCCTCAGCCCCACAGGCAGCGGAAGGAGTCTGAAACTCAGTGCCAGACTGAAAGTAAATACGACTCCGTGAGTGCC

Numéro d'accès Ensembl | souris

ENSMUSG00000031668

Numéro d'accès NCBI

NM_010121

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... EIF2AK3(13666) , Eif2ak3(13666)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yue Wang et al.
Antiviral research, 106, 33-41 (2014-04-01)
The unfolded protein response (UPR) is cyto-protective machinery elicited towards an influx of large amount of protein synthesis in the endoplasmic reticulum (ER). Extensive studies suggest that the UPR can also be activated during virus infection. In the present studies
Genkai Guo et al.
Journal of immunology research, 2015, 183738-183738 (2015-06-20)
Previous studies indicated that bone marrow mesenchymal stem cells (BM-MSCs) from patients with systemic lupus erythematosus (SLE) exhibited the phenomenon of apoptosis. In this study, we aimed to investigate whether apoptosis of BM-MSCs from SLE patients were dysregulated. In this
Fei Sun et al.
Toxicology, 325, 52-66 (2014-08-19)
While it has been well-documented that excessive fluoride exposure caused the skeletal disease and osteoblasts played a critical role in the advanced skeletal fluorosis, the underlying mechanism that mediated these effects remain poorly understood. The present study was undertaken to
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique