Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU156191

Sigma-Aldrich

MISSION® esiRNA

targeting human TM4SF1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF


Date d'expédition estimée le20 avril 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF


Date d'expédition estimée le20 avril 2025


Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATGAAAACTGTGGCAAACGATGTGCGATGCTTTCTTCTGTATTGGCTGCTCTCATTGGAATTGCAGGATCTGGCTACTGTGTCATTGTGGCAGCCCTTGGCTTAGCAGAAGGACCACTATGTCTTGATTCCCTCGGCCAGTGGAACTACACCTTTGCCAGCACTGAGGGCCAGTACCTTCTGGATACCTCCACATGGTCCGAGTGCACTGAACCCAAGCACATTGTGGAATGGAATGTATCTCTGTTTTCTATCCTCTTGGCTCTTGGTGGAATTGAATTCATCTTGTGTCTTATTCAAGTAATAAATGGAGTGCTTGGAGGCATATGTGGCTTTTGCTGCTCTCACCAACAGCAATATGACTGCTAAAAGAACCAACCCAGGACAGAGCCACAATCTTCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Young Ran Park et al.
International journal of oncology, 48(5), 2135-2143 (2016-03-18)
Transmembrane-4-L6 family 1 (TM4SF1) is upregulated in colorectal carcinoma (CRC). However, the mechanism leading to inhibition of the TM4SF1 is not known. In the present study, we investigated the regulation of TM4SF1 and function of microRNAs (miRNAs) in CRC invasion
Yu-Cheng Su et al.
mAbs, 6(4), 1069-1083 (2014-05-31)
Modification of antibody class and binding properties typically requires cloning of antibody genes, antibody library construction, phage or yeast display and recombinant antibody expression. Here, we describe an alternative "cloning-free" approach to generate antibodies with altered antigen-binding and heavy chain
Dong Xu et al.
Cancer biology & therapy, 21(4), 354-363 (2020-01-08)
Background: Transmembrane-4-L-six-family-1 (TM4SF1) functions to regulate cell growth and mobility and TM4SF1 expression was upregulated in pancreatic cancer. This study further investigated the role of TM4SF1 in regulating pancreatic cancer epithelial-mesenchymal transition (EMT) and angiogenesis and the underlying molecular events.Methods:
Yonghoon Kwon et al.
PloS one, 9(9), e108771-e108771 (2014-09-25)
5' AMP-activated protein kinase (AMPK) is a highly conserved serine-threonine kinase that regulates energy expenditure by activating catabolic metabolism and suppressing anabolic pathways to increase cellular energy levels. Therefore AMPK activators are considered to be drug targets for treatment of

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique