Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU146141

Sigma-Aldrich

MISSION® esiRNA

targeting human RNF8

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGACTTTGTCCTTTGTGGATTGCATAGCTGGATACCCATCATCTGTTTCTCTGATTGGAAGCTGCTGTTGTACAGAAAGACCTGCATTTCCCCCTTGTCTCCAGTTCTCTCACTACTTTTTCCTCCTCTGTGAGTGACCATCCAGGCAGTCACCATAACTGCTGGAGTGTCTGGGATTGGTAGCTCTCTCCAACTGCCTGCTTGCTCTTTACAGCCTCTCTCTGTGACTGGAATCTCTCCACCTCATCGTATCTAAGGATAACCCAGAAACATGGGGTGTCCTAGGTATGTTTATCTCGACACTGAACCCCCTAGGCTTCTGATGAATCCAGTGATTAGCTAAATTTGACATAGAAAGTAAGAAGGAATGTCTACTTTGTATTGTGGTCCTAATCTAAGATCAGGAGAATCCTGGAATTG

Numéro d'accès Ensembl | humain

ENSG00000112130

Numéro d'accès NCBI

NM_003958

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... RNF8(9025) , RNF8(9025)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number
XZU
ACIU
OWU
DJU
EWT

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Rechercher un(e) COA

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lu Min et al.
Acta biochimica et biophysica Sinica, 51(8), 791-798 (2019-07-12)
MicroRNAs (miRNAs) are a class of endogenous noncoding genes that regulate gene expression at the posttranscriptional level. In recent decades, miRNAs have been reported to play important roles in tumor growth and metastasis, while some reported functions of a specific
Yoshiyuki Sasaki et al.
International journal of medical sciences, 10(9), 1231-1241 (2013-08-13)
The optimal timing of surgical resection of liver metastasis remains controversial, and guidelines regarding the upper limits of operative indications have not yet been defined. Surgical indication for metastasis from colorectal cancer (CLM) based on results of preoperative chemotherapy and
Justine Sitz et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(39), 19552-19562 (2019-09-11)
High-risk human papillomaviruses (HR-HPVs) promote cervical cancer as well as a subset of anogenital and head and neck cancers. Due to their limited coding capacity, HPVs hijack the host cell's DNA replication and repair machineries to replicate their own genomes.
Shengli Wang et al.
Biochimica et biophysica acta, 1863(6), 1615-1628 (2017-02-22)
The ring finger protein 8 (RNF8), a key component of protein complex crucial for DNA-damage response, consists of a forkhead-associated (FHA) domain and a really interesting new gene (RING) domain that enables it to function as an E3 ubiquitin ligase.
Maoxin Wang et al.
Oncology reports, 34(1), 341-349 (2015-05-09)
Tumor residue or recurrence is common after radiation therapy for nasopharyngeal cancer (NPC) since the tumor cells can repair irradiation-induced DNA damage. The ubiquitination cascade mediates the assembly of repair and signaling proteins at sites of DNA double-strand breaks (DSBs).
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique