Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU109741

Sigma-Aldrich

MISSION® esiRNA

targeting human WDR5

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCCTGAAGACGTACACTGGCCACAAGAATGAGAAATACTGCATATTTGCCAATTTCTCTGTTACTGGTGGGAAGTGGATTGTGTCTGGCTCAGAGGATAACCTTGTTTACATCTGGAACCTTCAGACGAAAGAGATTGTACAGAAACTACAAGGCCACACAGATGTCGTGATCTCAACAGCTTGTCACCCAACAGAAAACATCATCGCCTCTGCTGCGCTAGAAAATGACAAAACAATTAAACTGTGGAAGAGTGACTGCTAAGTCCCTTTGCTCCTGCCCGCGAGAGACTGTCGGGAAGTTGACCCGGATTGGCAAGAAACAGGGTGTCTTGGAGGTGGTCCCCCAGATCTGCGCCTGGGGGTCAGGACAGGGCCTGATTTGAGCCTCCTCTCTGAAGATGATTTGGCCGAGCGGAAGGTGTGGACCACCGGAAAGTTCTTAAAAGTTGCTGGTGACATTTCTTGC

Numéro d'accès Ensembl | humain

ENSG00000196363

Numéro d'accès NCBI

NM_017588

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... WDR5(11091) , WDR5(11091)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Biao Ding et al.
Biology of reproduction, 96(4), 758-771 (2017-04-06)
WD repeat-containing protein 5 (WDR5), a member of conserved WD40 protein family, is an essential component of the mixed lineage leukemia (MLL) complexes, which are crucial for numerous key biological processes including methylation of histone H3 lysine 4 (H3K4), self-renewal
Xin Tan et al.
Cell death & disease, 8(3), e2686-e2686 (2017-03-17)
Colorectal cancer (CRC) is the third most common cause of cancer deaths, and has a high rate of liver and lung metastasis. Unfortunately, distant metastasis is the main barrier for advanced CRC therapy and leads to a very low survival
Bin Dai et al.
Cancer management and research, 12, 3223-3235 (2020-05-23)
Glioma is one of the important diseases that threaten human survival in today's society. WD repeat domain 5 (WDR5) belongs to the components of the lysine methyltransferase complex. WDR5 is involved in gene transcription regulation, cell senescence, cancer and other
Qianghua Zhou et al.
Theranostics, 11(10), 4809-4824 (2021-03-24)
Purpose: Advanced prostate cancer (PCa) has limited treatment regimens and shows low response to chemotherapy and immunotherapy, leading to poor prognosis. Histone modification is a vital mechanism of gene expression and a promising therapy target. In this study, we characterized
Di Huang et al.
OncoTargets and therapy, 13, 10525-10534 (2020-10-30)
The WD40 protein family member WD repeat domain 5 (WDR5) plays significant roles in the tumorigenesis and development of multiple organ tumours. However, the correlation between WDR5 expression and oesophageal squamous cell carcinoma (ESCC) has not been elucidated. WDR5 mRNA
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique