Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU100781

Sigma-Aldrich

MISSION® esiRNA

targeting human SREBF2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
249.00 CHF
50 μG
443.00 CHF

249.00 CHF


Date d'expédition estimée le22 avril 2025



Sélectionner une taille de conditionnement

Changer de vue
20 μG
249.00 CHF
50 μG
443.00 CHF

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

249.00 CHF


Date d'expédition estimée le22 avril 2025


Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCGCTCCTCCATCAATGACAAAATCATCGAATTGAAAGACCTGGTCATGGGGACAGACGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATACTTGCAGCAGGTCAATCATAAACTGCGCCAGGAGAACATGGTGCTGAAGCTGGCAAATCAAAAGAACAAGCTTCTAAAGGGCATCGACCTAGGCAGTCTGGTGGACAATGAGGTGGACCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Johan Fernø et al.
BMC neuroscience, 7, 69-69 (2006-10-21)
The etiology of schizophrenia is unknown, but neurodevelopmental disturbances, myelin- and oligodendrocyte abnormalities and synaptic dysfunction have been suggested as pathophysiological factors in this severe psychiatric disorder. Cholesterol is an essential component of myelin and has proved important for synapse
Demin Cai et al.
Nature communications, 10(1), 4621-4621 (2019-10-13)
Tumor subtype-specific metabolic reprogrammers could serve as targets of therapeutic intervention. Here we show that triple-negative breast cancer (TNBC) exhibits a hyper-activated cholesterol-biosynthesis program that is strongly linked to nuclear receptor RORγ, compared to estrogen receptor-positive breast cancer. Genetic and
Silvia Cetrullo et al.
Cells, 9(3) (2020-03-01)
While high levels of saturated fatty acids are associated with impairment of cardiovascular functions, n-3 polyunsaturated fatty acids (PUFAs) have been shown to exert protective effects. However the molecular mechanisms underlying this evidence are not completely understood. In the present
Paul Lebeau et al.
The Journal of biological chemistry, 292(4), 1510-1523 (2016-12-03)
Accumulating evidence implicates endoplasmic reticulum (ER) stress as a mediator of impaired lipid metabolism, thereby contributing to fatty liver disease and atherosclerosis. Previous studies demonstrated that ER stress can activate the sterol regulatory element-binding protein-2 (SREBP2), an ER-localized transcription factor
Shuofeng Yuan et al.
Nature communications, 10(1), 120-120 (2019-01-12)
Viruses are obligate intracellular microbes that exploit the host metabolic machineries to meet their biosynthetic demands, making these host pathways potential therapeutic targets. Here, by exploring a lipid library, we show that AM580, a retinoid derivative and RAR-α agonist, is

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique