Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU088591

Sigma-Aldrich

MISSION® esiRNA

targeting human NR3C2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATTCATGTTCAGGCACCTCTTTTAAAGGGAATCCAACAGTAAACCCGTTTCCATTTATGGATGGCTCGTATTTTTCCTTTATGGATGATAAAGACTATTATTCCCTATCAGGAATTTTAGGACCACCTGTGCCCGGCTTTGATGGTAACTGTGAAGGCAGCGGATTCCCAGTGGGTATTAAACAAGAACCAGATGATGGGAGCTATTACCCAGAGGCCAGCATCCCTTCCTCTGCTATTGTTGGGGTGAATTCAGGTGGACAGTCCTTCCACTACAGGATTGGTGCTCAAGGTACAATATCTTTATCACGATCGGCTAGAGACCAATCTTTCCAACACCTGAGTTCCTTTCCTCCTGTCAATACTTTAGTGGAGTCATGGAAATCACACGGCGACCTGTCGTCTAGAAGAAGTGATGGGTATCCGGTC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kunihiro Hayakawa et al.
International journal of molecular sciences, 20(4) (2019-02-17)
MicroRNA (miRNA) is small RNA of 20 to 22 nucleotides in length and is stably present in plasma. Regulating the expression of miRNA taken into cells has been suggested as a general therapeutic approach. We identified the novel anti-inflammatory miRNA
Moshe Shashar et al.
Nitric oxide : biology and chemistry, 80, 24-31 (2018-07-30)
Blockade of the mineralocorticoid receptor (MCR) has been shown to improve endothelial function far beyond blood pressure control. In the current studies we have looked at the effect of MCR antagonists on cationic amino acid transporter-1 (CAT-1), a major modulator

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique