Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU074981

Sigma-Aldrich

MISSION® esiRNA

targeting human DOCK4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGCTTGAGCAGGCACAGATTCTGGAATTTGGTTTGGCCGTGCATGAGAAGTTTGTACCTCAAGATATGAGACCCCTTCACAAAAAGCTGGTTGACCAATTCTTTGTGATGAAGTCGAGCTTAGGGATACAGGAGTTCTCTGCTTGTATGCAAGCCAGTCCTGTCCATTTTCCTAATGGAAGCCCTCGTGTGTGTAGAAACTCAGCACCTGCTTCTGTGAGCCCAGATGGTACCAGGGTAATTCCTAGACGCAGCCCGTTAAGTTACCCAGCTGTCAACCGATATTCTTCCTCCTCACTGTCCTCACAAGCTTCTGCTGAAGTAAGCAATATTACAGGGCAATCAGAAAGCTCTGATGAAGTCTTTAACATGCAGCCAAGTCCATCTACCTCAAGCTTGAGTTCTACTCACTCGGCTTCACCTAATGTGACAAGTTCTGCTCCATCG

Numéro d'accès Ensembl | humain

ENSG00000128512

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DOCK4(9732) , DOCK4(9732)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Sriram Sundaravel et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(18), 5638-5649 (2019-07-17)
Myelodysplastic syndromes (MDS) with deletion of chromosome 7q/7 [-7/(del)7q MDS] is associated with worse outcomes and needs novel insights into pathogenesis. Reduced expression of signaling protein dedicator of cytokinesis 4 (DOCK4) in patients with -7/(del)7q MDS leads to a block
Sriram Sundaravel et al.
Proceedings of the National Academy of Sciences of the United States of America, 112(46), E6359-E6368 (2015-11-19)
Anemia is the predominant clinical manifestation of myelodysplastic syndromes (MDS). Loss or deletion of chromosome 7 is commonly seen in MDS and leads to a poor prognosis. However, the identity of functionally relevant, dysplasia-causing, genes on 7q remains unclear. Dedicator

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique