Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU022821

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGTGGCAAACTGGTACTTTGGGAACTTCCTATGCAAGGCAGTCCATGTCATCTACACAGTCAACCTCTACAGCAGTGTCCTCATCCTGGCCTTCATCAGTCTGGACCGCTACCTGGCCATCGTCCACGCCACCAACAGTCAGAGGCCAAGGAAGCTGTTGGCTGAAAAGGTGGTCTATGTTGGCGTCTGGATCCCTGCCCTCCTGCTGACTATTCCCGACTTCATCTTTGCCAACGTCAGTGAGGCAGATGACAGATATATCTGTGACCGCTTCTACCCCAATGACTTGTGGGTGGTTGTGTTCCAGTTTCAGCACATCATGGTTGGCCTTATCCTGCCTGGTATTGTCATCCTGTCCTGCTATTGCATTATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACCACAGTCATCCTCATCCTGGCTTTCTTCGCCTGTTGGCTGCCTTACTACATTGGGATCAGCATCGACTC

Numéro d'accès Ensembl | humain

ENSG00000121966

Numéro d'accès NCBI

NM_001008540

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CXCR4(7852) , CXCR4(7852)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Lei Li et al.
Biochimica et biophysica acta. General subjects, 1862(8), 1790-1800 (2018-05-08)
HIV infection and/or the direct pathogenic effects of circulating HIV proteins impairs the physiological function of mesenchymal stem cells (MSCs), and contribute to the pathogenesis of age-related clinical comorbidities in people living with HIV. The SDF-1/CXCR4 pathway is vital for
Zhi-Yu Song et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 46-52 (2015-05-12)
Chemokine CXCL12 is an extracellular chemokine, which binds to its cell surface receptor CXCR4. High expressions of CXCR4 and CXCL12 are associated with biological malignant potential in colon cancers. We aimed to investigate the roles of the CXCR4/CXCL12 axis in
Markus Eberl et al.
EMBO molecular medicine, 4(3), 218-233 (2012-02-02)
Inhibition of Hedgehog (HH)/GLI signalling in cancer is a promising therapeutic approach. Interactions between HH/GLI and other oncogenic pathways affect the strength and tumourigenicity of HH/GLI. Cooperation of HH/GLI with epidermal growth factor receptor (EGFR) signalling promotes transformation and cancer
Ying Wang et al.
Frontiers in oncology, 9, 1487-1487 (2020-02-13)
Purpose: Due to a lack of recognized molecular targets for therapy, patients with triple-negative breast cancer (TNBC), unlike other subtypes of breast cancers, generally have not benefited from the advances made with targeted agents. The CXCR4/SDF-1 axis is involved in
Lusheng Wei et al.
Cell death & disease, 9(11), 1065-1065 (2018-10-20)
Cancer-associated fibroblasts (CAFs), a dominant component of the pancreatic tumor microenvironment, are mainly considered as promotors of malignant progression, but the underlying molecular mechanism remains unclear. Here, we show that SDF-1 secreted by CAFs stimulates malignant progression and gemcitabine resistance
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique