Direkt zum Inhalt
Merck

EHU158661

Sigma-Aldrich

MISSION® esiRNA

targeting human NONO

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAAATCTTCCTCCCGACATCACTGAGGAAGAAATGAGGAAACTATTTGAGAAATATGGAAAGGCAGGCGAAGTCTTCATTCATAAGGATAAAGGATTTGGCTTTATCCGCTTGGAAACCCGAACCCTAGCGGAGATTGCCAAAGTGGAGCTGGACAATATGCCACTCCGTGGAAAGCAGCTGCGTGTGCGCTTTGCCTGCCATAGTGCATCCCTTACAGTTCGAAACCTTCCTCAGTATGTGTCCAACGAACTGCTGGAAGAAGCCTTTTCTGTGTTTGGCCAGGTAGAGAGGGCTGTAGTCATTGTGGATGATCGAGGAAGGCCCTCAGGAAAAGGCATTGTTGAGTTCTCAGGGAAGCCAGCTGCTCGGAAAGCTCTGGACAGATGCAGTGAAGGCTCCTTCCTGCTAACCACATTTCCTCGTCCTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rui Cheng et al.
Oncology reports, 39(6), 2575-2583 (2018-04-06)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignancies in China, and is associated with high morbidity and mortality. However, the molecular mechanisms that control ESCC tumorigenicity and metastasis remain unclear. Here, we report that the RNA
Taotao Han et al.
The Journal of clinical investigation, 130(7), 3901-3918 (2020-06-17)
Chronic infections can lead to carcinogenesis through inflammation-related mechanisms. Chronic infection of the human gastric mucosa with Helicobacter pylori is a well-known risk factor for gastric cancer. However, the mechanisms underlying H. pylori-induced gastric carcinogenesis are incompletely defined. We aimed
Lotte Victoria Winther Stagsted et al.
eLife, 10 (2021-01-22)
Circular RNAs (circRNAs) represent an abundant and conserved entity of non-coding RNAs; however, the principles of biogenesis are currently not fully understood. Here, we identify two factors, splicing factor proline/glutamine rich (SFPQ) and non-POU domain-containing octamer-binding protein (NONO), to be
Jarrod S Johnson et al.
Cell reports, 30(3), 914-931 (2020-01-23)
Transcriptional programming of the innate immune response is pivotal for host protection. However, the transcriptional mechanisms that link pathogen sensing with innate activation remain poorly understood. During HIV-1 infection, human dendritic cells (DCs) can detect the virus through an innate
Asma Chaoui et al.
Human molecular genetics, 24(17), 4933-4947 (2015-06-11)
SOX10 is a transcription factor with well-known functions in neural crest and oligodendrocyte development. Mutations in SOX10 were first associated with Waardenburg-Hirschsprung disease (WS4; deafness, pigmentation defects and intestinal aganglionosis). However, variable phenotypes that extend beyond the WS4 definition are

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.