Direkt zum Inhalt
Merck

EHU148311

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA1A (2)

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGAGTCCTACGCCTTCAACATGAAGAGCGCCGTGGAGGATGAGGGGCTCAAGGGCAAGATCAGCGAGGCGGACAAGAAGAAGGTGCTGGACAAGTGTCAAGAGGTCATCTCGTGGCTGGACGCCAACACCTTGGCCGAGAAGGACGAGTTTGAGCACAAGAGGAAGGAGCTGGAGCAGGTGTGTAACCCCATCATCAGCGGACTGTACCAGGGTGCCGGTGGTCCCGGGCCTGGGGGCTTCGGGGCTCAGGGTCCCAAGGGAGGGTCTGGGTCAGGCCCCACCATTGAGGAGGTAGATTAGGGGCCTTTCCAAGATTGCTGTTTTTGTTTTGGAGCTTCAAGACTTTGCATTTCCTAGTATTTCTGTTTGTCAGTTCTCAATTTCCTGTGTTTGCAATGTTGAAATTTTTTGGTGAAGTACTGAACTTGCTTTTTTTCCGGTTTCTACATGCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ilse M Beck et al.
PloS one, 8(7), e69115-e69115 (2013-08-13)
Compound A possesses glucocorticoid receptor (GR)-dependent anti-inflammatory properties. Just like classical GR ligands, Compound A can repress NF-κB-mediated gene expression. However, the monomeric Compound A-activated GR is unable to trigger glucocorticoid response element-regulated gene expression. The heat shock response potently
Chungen Yan et al.
International journal of clinical and experimental medicine, 8(4), 5746-5752 (2015-07-02)
To explore the ultrasound-guided gene transfection as well as the role of heat shock protein 72 (HSP72) siRNA combined with ultrasound micro-bubble contrast agents on rat hepatic ischemia-reperfusion injury. 72 SD rats were divided into non-surgery group (group N), sham-operation
Salvador Mena et al.
PloS one, 7(9), e44524-e44524 (2012-09-08)
The phenolic phytoalexin resveratrol is well known for its health-promoting and anticancer properties. Its potential benefits are, however, limited due to its low bioavailability. Pterostilbene, a natural dimethoxylated analog of resveratrol, presents higher anticancer activity than resveratrol. The mechanisms by
Taek-Keun Kim et al.
Biochemical and biophysical research communications, 469(2), 222-228 (2015-12-15)
Heat shock protein 70-1A (HSP70-1A) is a stress-inducible protein that provides an essential intracellular molecular chaperone function; however, the mechanism of HSP70-1A in angiogenesis has not been clarified. Herein, HSP70-1A gene silencing implicated this protein in angiogenesis. Additionally, recombinant human

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.