Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU077661

Sigma-Aldrich

MISSION® esiRNA

targeting human SPP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAAAAGGAGAAAAAATACAATTTCTCACTTTGCATTTAGTCAAAAGAAAAAATGCTTTATAGCAAAATGAAAGAGAACATGAAATGCTTCTTTCTCAGTTTATTGGTTGAATGTGTATCTATTTGAGTCTGGAAATAACTAATGTGTTTGATAATTAGTTTAGTTTGTGGCTTCATGGAAACTCC

Ensembl | Human Hinterlegungsnummer

ENSG00000118785

NCBI-Hinterlegungsnummer

NM_000582

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SPP1(6696) , SPP1(6696)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yao Fan et al.
Bone research, 8, 9-9 (2020-03-05)
Osteocytes are mechanosensitive bone cells, but little is known about their effects on tumor cells in response to mechanical stimulation. We treated breast cancer cells with osteocyte-derived conditioned medium (CM) and fluid flow-treated conditioned medium (FFCM) with 0.25 Pa and 1 Pa
Beibei Zhang et al.
Experimental and therapeutic medicine, 20(4), 3633-3642 (2020-08-29)
The metastatic behavior of hepatocellular carcinoma (HCC) is one of the key factors that leads to poor prognosis. The aim of the current study was to determine the changes in metastasis and the proliferation potential of bone marrow mesenchymal stem
Sheng-Li Hu et al.
Molecular neurobiology, 52(1), 236-243 (2014-08-26)
Neurosurgical operations may result in surgical injury which would lead to postoperative neurological deficits. Hyperbaric oxygen preconditioning (HBO-PC) may be beneficial for such people. However, the exact mechanism underlying HBO-PC is not well known yet. The aim of this study
Huan Yu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 35(3), e21405-e21405 (2021-02-10)
Microglia activation and release of pro-inflammatory cytokines have been closely linked to glaucoma. However, the mechanisms that initiate these pathways remain unclear. Here, we investigated the role of a pro-inflammatory cytokine--osteopontin (OPN), in retinal microglia activation process along with the
Iman A Mohamed et al.
PloS one, 10(4), e0123318-e0123318 (2015-04-18)
Enhanced expression and activity of the Na+/H+ exchanger isoform 1 (NHE1) has been implicated in cardiomyocyte hypertrophy in various experimental models. The upregulation of NHE1 was correlated with an increase in osteopontin (OPN) expression in models of cardiac hypertrophy (CH)
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.