Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU050181

Sigma-Aldrich

MISSION® esiRNA

targeting human LRG1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCATCTCCTGTCAACCACCTGCCGAAATCCCCGGCTACCTGCCAGCCGACACCGTGCACCTGGCCGTGGAATTCTTCAACCTGACCCACCTGCCAGCCAACCTCCTCCAGGGCGCCTCTAAGCTCCAAGAATTGCACCTCTCCAGCAATGGGCTGGAAAGCCTCTCGCCCGAATTCCTGCGGCCAGTGCCGCAGCTGAGGGTGCTGGATCTAACCCGAAACGCCCTGACCGGGCTGCCCCCGGGCCTCTTCCAGGCCTCAGCCACCCTGGACACCCTGGTATTGAAAGAAAACCAGCTGGAGGTCCTGGAGGTCTCGTGGCTACACGGCCTGAAAGCTCTGGGGCATCTGGACCTGTCTGGGAACCGCCTCCGGAAACTGCCCCCCGGGCTGCTGGCCAACTTCACCCTCCTGCGCACCCTTGACCTTGGGGAGAACCAGTTGGAGACCTTGC

Ensembl | Human Hinterlegungsnummer

ENSG00000171236

NCBI-Hinterlegungsnummer

NM_052972

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LRG1(116844) , LRG1(116844)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lan Luan et al.
Experimental and therapeutic medicine, 21(4), 367-367 (2021-03-19)
Retinoblastoma (RB) is the most common primary intraocular cancer type that occurs during retinal development in childhood. Previous studies have reported that long non-coding RNAs (lncRNAs) are involved in the development of RB. Therefore, the aim of the present study
Yiyun Wang et al.
Cell death & disease, 8(3), e2715-e2715 (2017-03-31)
The incomplete understanding of aberrant neovascularization, which contributes to osteoarthritis suggests that additional modulators have yet to be identified. Our objective was to identify the role of Leucine-rich-alpha-2-glycoprotein1 (LRG1), a new regulator of pathogenic angiogenesis, in osteoarthritis progression and to
Qian Zhang et al.
OncoTargets and therapy, 11, 2745-2752 (2018-05-23)
Leucine-rich α-2-glycoprotein-1 (LRG1) is differentially expressed in many kinds of diseases including cancer, however, it has not been thoroughly studied yet. The objective of this study was to detect the expression and potential mechanism of LRG1 in colorectal cancer (CRC).
Masaaki Yamamoto et al.
Cancer science, 108(10), 2052-2060 (2017-07-27)
Gastric cancer is one of the most common malignant tumors. Although improvement in chemotherapy has been achieved, the clinical prognosis of advanced gastric cancer remains poor. Therefore, it is increasingly important to predict the prognosis and determine whether patients should
Gu Gong et al.
Journal of molecular neuroscience : MN, 54(1), 20-26 (2014-02-15)
Lipopolysaccharide (LPS) preconditioning is a powerful neuroprotective phenomenon by which an injurious stimulus renders the brain resistant to a subsequent damaging ischemic insult. The LPS response gene (Lrg) is a recently identified gene in human dental pulp cells treated with
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.