Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

View All Documentation

EHU017981

Sigma-Aldrich

MISSION® esiRNA

targeting human GPNMB

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTGCAGAAATGAGGCTGGTTTATCTGCTGATCCGTATGTTTACAACTGGACAGCATGGTCAGAGGACAGTGACGGGGAAAATGGCACCGGCCAAAGCCATCATAACGTCTTCCCTGATGGGAAACCTTTTCCTCACCACCCCGGATGGAGAAGATGGAATTTCATCTACGTCTTCCACACACTTGGTCAGTATTTCCAGAAATTGGGACGATGTTCAGTGAGAGTTTCTGTGAACACAGCCAATGTGACACTTGGGCCTCAACTCATGGAAGTGACTGTCTACAGAAGACATGGACGGGCATATGTTCCCATCGCACAAGTGAAAGATGTGTACGTGGTAACAGATCAGATTCCTGTGTTTGTGACTATGTTCCAGAAGAACGATCGAAATTCATCCGACGAAACCTTCCTCAAAGATCTCCCC

Ensembl | Human Hinterlegungsnummer

ENSG00000136235

NCBI-Hinterlegungsnummer

NM_001005340
NM_002510

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... GPNMB(10457) , GPNMB(10457)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Rui Jin et al.
Oncology reports, 39(6), 3034-3040 (2018-04-06)
Glycoprotein non‑metastatic melanoma protein B (GPNMB) is a glycoprotein that is highly expressed in various types of cancer, including osteosarcoma. However, its cellular functions and related mechanisms in osteosarcoma remain unclear. In the present study, a higher GPNMB mRNA level was
Feifei Ren et al.
Journal of cellular physiology, 235(3), 2738-2752 (2019-09-10)
Gastric cancer has the fifth highest incidence of disease and is the third leading cause of cancer-associated mortality in the world. The etiology of gastric cancer is complex and needs to be fully elucidated. Thus, it is necessary to explore
Basilio Smuczek et al.
Experimental cell research, 358(2), 323-334 (2017-07-10)
Breast cancer is an important public health problem, and its progression may be related to the extracellular matrix (ECM), which acts as a structural scaffold and instruction source for neoplastic cells. Laminins are ECM proteins regulating tumor biology. The laminin-derived
Kazal Boron Biswas et al.
Scientific reports, 10(1), 4930-4930 (2020-03-20)
GPNMB is involved in multiple cellular functions including cell adhesion, stress protection and stem cell maintenance. In skin, melanocyte-GPNMB is suggested to mediate pigmentation through melanosome formation, but details of keratinocyte-GPNMB have yet to be well understood. We confirmed the
Kotaro Kumagai et al.
PloS one, 10(11), e0143413-e0143413 (2015-11-26)
Glycoprotein nonmetastatic melanoma B (Gpnmb), a transmembrane glycoprotein that is expressed in macrophages, negatively regulates inflammation. We have reported that Gpnmb is strongly expressed in the livers of rats fed a choline-deficient, L-amino acid-defined (CDAA) diet. However, the role of
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.