Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU009531

Sigma-Aldrich

MISSION® esiRNA

targeting human PLA2G4A

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGGCCTTGGTGAGTGATTCAGCTTTATTCAATACCAGAGAAGGACGTGCTGGGAAGGTACACAACTTCATGCTGGGCTTGAATCTCAATACATCTTATCCACTGTCTCCTTTGAGTGACTTTGCCACACAGGACTCCTTTGATGATGATGAACTGGATGCAGCTGTAGCAGATCCTGATGAATTTGAGCGAATATATGAGCCTCTGGATGTCAAAAGTAAAAAGATTCATGTAGTGGACAGTGGGCTCACATTTAACCTGCCGTATCCCTTGATACTGAGACCTCAGAGAGGGGTTGATCTCATAATCTCCTTTGACTTTTCTGCAAGGCCAAGTGACTCTAGTCCTCCGTTCAAGGAACTTCTACTTGCAGAAAAGTGGGCTAAAATGAACAAGCTCCCCTTTCCAAAGATTGATCCTTATGTGTTTGATCGGGAAGGGCTGAAGGAGTGCTATGTCTTTAAACCCAAGAATCCTGATATGGAGAAAGATTGCCCAACCATCATCCACTTTGTTCTGGCCAACATCA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nikos Koundouros et al.
Cell, 181(7), 1596-1611 (2020-06-20)
Oncogenic transformation is associated with profound changes in cellular metabolism, but whether tracking these can improve disease stratification or influence therapy decision-making is largely unknown. Using the iKnife to sample the aerosol of cauterized specimens, we demonstrate a new mode
Chinmoy Sarkar et al.
Autophagy, 16(3), 466-485 (2019-06-27)
Lysosomal membrane permeabilization (LMP) is observed under many pathological conditions, leading to cellular dysfunction and death. However, the mechanisms by which lysosomal membranes become leaky in vivo are not clear. Our data demonstrate that LMP occurs in neurons following controlled
Dennis Y Chuang et al.
Journal of neuroinflammation, 12, 199-199 (2015-11-02)
Oxidative stress and inflammation are important factors contributing to the pathophysiology of numerous neurological disorders, including Alzheimer's disease, Parkinson's disease, acute stroke, and infections of the brain. There is well-established evidence that proinflammatory cytokines and glutamate, as well as reactive

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique