EHUFLUC
MISSION® esiRNA
targeting FLUC
Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
About This Item
Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51
Produits recommandés
Description
Powered by Eupheria Biotech
Gamme de produits
MISSION®
Forme
lyophilized powder
Conditions d'expédition
ambient
Température de stockage
−20°C
Catégories apparentées
Description générale
EHUFLUC targets Firefly Luciferase. It can be used as a negative control in systems lacking Firefly Luciferase, or a positive knockdown control in systems expressing it.
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Autres remarques
esiRNA cDNA target sequence: GAGCAACTGCATAAGGCTATGAAGAGATACGCCCTGGTTCCTGGAACAATTGCTTTTACAGATGCACATATCGAGGTGGACATCACTTACGCTGAGTACTTCGAAATGTCCGTTCGGTTGGCAGAAGCTATGAAACGATATGGGCTGAATACAAATCACAGAATCGTCGTATGCAGTGAAAACTCTCTTCAATTCTTTATGCCGGTGTTGGGCGCGTTATTTATCGGAGTTGCAGTTGCGCCCGCGAACGACATTTATAATGAACGTGAATTGCTCAACAGTATGGGCATTTCGCAGCCTACCGTGGTGTTCGTTTCCAAAAAGGGGTTGCAAAAAATTTTGAACGTGCAAAAAAAGCTCCCAATCATCCAAAAAATTATTATCATGGATTCTAAAACGGATTACCAGGGATTTCAGTCGATGTACACGTTCGTCACATCTCATCTACCTCCCGGTTTTAATGAATACGATTTTGTGCCAGAGTCCTTCGATAGGGACAAGACAATTGCACTGATCATGAACTCCTCTGGATCTACTGGTCTGCCTAAAGGTGTCGCTCTGCCTCATAGAACTGCCTGCGTGAGATT
Informations légales
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Code de la classe de stockage
10 - Combustible liquids
Classe de danger pour l'eau (WGK)
WGK 1
Point d'éclair (°F)
Not applicable
Point d'éclair (°C)
Not applicable
Certificats d'analyse (COA)
Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".
Déjà en possession de ce produit ?
Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.
Les clients ont également consulté
Ann Hammarstedt et al.
Scientific reports, 8(1), 15757-15757 (2018-10-27)
Adipose tissue dysfunction is considered an important contributor to systemic insulin resistance and Type 2 diabetes (T2D). Recently, a novel family of endogenous lipids, palmitic acid hydroxy stearic acids (PAHSAs), was discovered. These have anti-diabetic and anti-inflammatory effects in mice
Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Laura Lee et al.
PloS one, 14(5), e0213116-e0213116 (2019-05-22)
The mitochondrial outer membrane protein Mitochondrial Fission Factor (Mff) plays a key role in both physiological and pathological fission. It is well established that at stressed or functionally impaired mitochondria, PINK1 recruits the ubiquitin ligase Parkin which ubiquitinates Mff and
Annamaria Morotti et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 35(12), 2423-2431 (2020-08-12)
A role for long non-coding RNAs (lncRNAs) in endocrine cancer pathogenesis is emerging. However, knowledge regarding their expression pattern, correlation with known genetic defects, and clinical implications in parathyroid tumors is still unclear. Here, we profiled 90 known lncRNAs in
Theodora Saridaki et al.
Journal of neurochemistry, 146(4), 474-492 (2018-05-11)
Parkinson's disease can be caused by mutations in the α-synuclein gene and is characterized by aggregates of α-synuclein protein. We have previously shown that over-expression of the small GTPase Rab7 can induce clearance of α-synuclein aggregates. In this study, we
Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..
Contacter notre Service technique