Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU109221

Sigma-Aldrich

MISSION® esiRNA

targeting human TARDBP

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGCCGAACCTAAGCACAATAGCAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCAGGGTGGATTTGGTAATAGCAGAGGGGGTGGAGCTGGTTTGGGAAACAATCAAGGTAGTAATATGGGTGGTGGGATGAACTTTGGTGCGTTCAGCATTAATCCAGCCATGATGGCTGCCGCCCAGGCAGCACTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCAGTCAGGCCCATCGGGTAATAACCAAAACCAAGGCAACATGCAGAGGGAGCCAAACCAGGCCTTCGGTTCTGGAAATAACTCTTATAGTGGCTCTAATTCTGGTGCAGCAATTGGTTGGGGATCAGCATCCAATGCAGGGTCGGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGATTCTAAGTCTTCTGGCTGGGGAATGTAGAC

Numéro d'accès Ensembl | humain

ENSG00000120948

Numéro d'accès NCBI

NM_007375

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TARDBP(23435) , TARDBP(23435)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

12 - Non Combustible Liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xiaowei Chen et al.
Protein & cell, 9(10), 848-866 (2017-09-28)
Aberrant regulation of miRNA genes contributes to pathogenesis of a wide range of human diseases, including cancer. The TAR DNA binding protein 43 (TDP-43), a RNA/DNA binding protein associated with neurodegeneration, is involved in miRNA biogenesis. Here, we systematically examined
Seiichi Nagano et al.
Acta neuropathologica, 140(5), 695-713 (2020-08-18)
Mislocalization and abnormal deposition of TDP-43 into the cytoplasm (TDP-43 proteinopathy) is a hallmark in neurons of amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD). However, the pathogenic mechanism of the diseases linked to TDP-43 is largely unknown. We
Bin Bao et al.
Molecular cancer research : MCR, 18(12), 1803-1814 (2020-09-12)
Triple-negative breast cancer (TNBC) is a subtype of breast cancer that lacks expression of estrogen receptor, progesterone receptor, and the HER2 but is enriched with cancer stem cell-like cells (CSC). CSCs are the fraction of cancer cells recognized as the
Michael E Ward et al.
The Journal of experimental medicine, 211(10), 1937-1945 (2014-08-27)
Frontotemporal dementia (FTD) is the most common cause of dementia in people under 60 yr of age and is pathologically associated with mislocalization of TAR DNA/RNA binding protein 43 (TDP-43) in approximately half of cases (FLTD-TDP). Mutations in the gene
Alexander Gulliver Bjørnholt Grønning et al.
Nucleic acids research, 48(13), 7099-7118 (2020-06-20)
Nucleotide variants can cause functional changes by altering protein-RNA binding in various ways that are not easy to predict. This can affect processes such as splicing, nuclear shuttling, and stability of the transcript. Therefore, correct modeling of protein-RNA binding is
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique