Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU080041

Sigma-Aldrich

MISSION® esiRNA

targeting human BTG3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGGGCCCTTGATAAGGTTACCTCTGATTATCATTCAGGATCCTCTTCTTCAGATGAAGAAACAAGTAAGGAAATGGAAGTGAAACCCAGTTCGGTGACTGCAGCCGCAAGTCCTGTGTACCAGATTTCAGAACTTATATTTCCACCTCTTCCAATGTGGCACCCTTTGCCCAGAAAAAAGCCAGGAATGTATCGAGGGAATGGCCATCAGAATCACTATCCTCCTCCTGTTCCATTTGGTTATCCAAATCAGGGAAGAAAAAATAAACCATATCGCCCAATTCCAGTGACATGGGTACCTCCTCCTGGAATGCATTGTGACCGGAATCACTGGATTAATCCTCACATGTTAGCACCTCACTAACTTCGTTTTTGATTGTGTTGGTGTCATGTTGAGAAAAAGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Qi An et al.
Reproductive sciences (Thousand Oaks, Calif.), 24(10), 1462-1468 (2017-02-12)
Epithelial ovarian cancer (EOC) is the leading cause of cancer-related death among all the gynecological malignancies of the female genital system, and its incidence and mortality rates continue to rise. B-cell translocation gene 3 (BTG3) plays an important role in
Xinfang Yu et al.
Journal of hematology & oncology, 13(1), 40-40 (2020-05-03)
Aberrant activation of DNA damage response (DDR) is a major cause of chemoresistance in colorectal cancer (CRC). CHK1 is upregulated in CRC and contributes to therapeutic resistance. We investigated the upstream signaling pathways governing CHK1 activation in CRC. We identified

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique