Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU011031

Sigma-Aldrich

MISSION® esiRNA

targeting human TLR7

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGAAGTTGGCTTCTGCTCAAATGCCAGAACTTCTGTAGAAAGTTATGAACCCCAGGTCCTGGAACAATTACATTATTTCAGATATGATAAGTATGCAAGGAGTTGCAGATTCAAAAACAAAGAGGCTTCTTTCATGTCTGTTAATGAAAGCTGCTACAAGTATGGGCAGACCTTGGATCTAAGTAAAAATAGTATATTTTTTGTCAAGTCCTCTGATTTTCAGCATCTTTCTTTCCTCAAATGCCTGAATCTGTCAGGAAATCTCATTAGCCAAACTCTTAATGGCAGTGAATTCCAACCTTTAGCAGAGCTGAGATATTTGGACTTCTCCAACAACCGGCTTGATTTACTCCATTCAACAGCATTTGAAGAGCTTCACAAACTGGAAGTTCTGGATATAAGCAGTAATAGCCATTATTTTCAATCAGAAGGAATTACTCATATGCTAAACTTTACCAAGAACCTAAAGGTTCTGCAGAAACTGATGATGAACGACAATGACATCTCTTCCTCCACCAGCAG

Numéro d'accès Ensembl | humain

ENSG00000196664

Numéro d'accès NCBI

NM_016562

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TLR7(51284) , TLR7(51284)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nuoyan Zheng et al.
JCI insight, 5(14) (2020-07-24)
TLR7 has been linked to the pathogenesis of glomerulonephritis, but its precise roles are not clear. In this study, we evaluated the roles of TLR7 in IgA nephropathy (IgAN). TLR7 proteins were abundant in CD19+ B cells infiltrated in the
Yayi Huang et al.
Revista da Associacao Medica Brasileira (1992), 65(8), 1067-1073 (2019-09-19)
Diabetes is a risk factor for acute kidney injury (AKI). However, its mechanism of pathogenesis has not been elucidated. The aim of the study was to investigate the role of inflammation and the toll-like receptor 7 (TLR7) in ischemic AKI
Federica Liotti et al.
Cancers, 13(4) (2021-02-14)
Pattern recognition receptors (PRR) promote inflammation but also its resolution. We demonstrated that a specific PRR-formyl peptide receptor 1 (FPR1)-sustains an inflammation resolution response with anti-angiogenic and antitumor potential in gastric cancer. Since toll-like receptor 7 (TLR7) is crucial in
Yun-Ru Liao et al.
Biochemical and biophysical research communications, 493(2), 1136-1142 (2017-08-28)
Diabetic retinopathy (DR) is a major microvascular complication of diabetes, resulting in neuronal dysfunction, retinal vascular leakage, and apoptosis within the retina. Innate immunity plays an important role in the pathogenesis of type 2 diabetes (T2D) and related complications. The
Ryoichiro Nishibayashi et al.
PloS one, 10(6), e0129806-e0129806 (2015-06-18)
Interleukin-12 (IL-12) is an important cytokine for the immunomodulatory effects of lactic acid bacteria (LAB). Using murine immune cells, we previously reported that the RNA of Enterococcus faecalis EC-12, a LAB strain exerting probiotic-like beneficial effects, is the major IL-12-inducing

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique