Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU183631

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mki67

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAACTTCAGAGACACAGGCAAGAAGAAGACTCAGGAGACTGGTTGTTACTGAAGAGCCCATACCACAAAGAAAGACTACAAGAGTTGTAAGGCAAACCAGAAACACACAGAAAGAGCCCATAAGTGACAATCAAGGTATGGAAGAGTTTAAGGAATCTTCAGTACAGAAACAAGACCCAAGTGTAAGTTTAACTGGCAGGAGGAACCAACCAAGGACAGTTAAGGAGAAAACCCAACCCTTAGAAGAACTCACCAGTTTCCAAGAGGAAACTGCCAAAAGAATATCTTCCAAATCTCCACAACCGGAAGAGAAGGAAACCTTAGCAGGTTTAAAGAGGCAGCTCAGAATACAACTAATCAACGATGGTGTAAAAGAAGAGCCCACAGCACAGAGAAAGCAACCATCCAGGGAAACCAGGAACACACTCAAAGAGCCTGTAGGTGACAGTATAAATGTTGAAGAGGTTAAGAAGTCTACAAAGCAGAAAATTGATCCAGTAGCAAGTGTGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xu Zhou et al.
Scientific reports, 5, 10071-10071 (2015-05-12)
Cancer neovascularization plays an essential role in the metastasis of larynx carcinoma (LC). However, the underlying molecular mechanisms are not completely understood. Recently, we reported that placental growth factor (PLGF) regulates expression of matrix metalloproteinase 3 (MMP3) through ERK/MAPK signaling
Kanako Tamura et al.
PloS one, 10(5), e0126003-e0126003 (2015-05-06)
Glucagon-like peptide-1 (GLP-1) receptor agonists potentiate glucose-induced insulin secretion. In addition, they have been reported to increase pancreatic beta cell mass in diabetic rodents. However, the precise mode of action of GLP-1 receptor agonists still needs to be elucidated. Here
David W Chapman et al.
EJNMMI research, 4(1), 27-27 (2015-06-28)
The multitargeting tyrosine kinase inhibitor (TKI) sunitinib is currently the first-line drug therapy for metastasizing renal cell carcinoma (RCC). TKIs have profound effects on tumor angiogenesis, leading to modifications of the tumor microenvironment. The goal of this study was to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique