Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU037431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Syp

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CAGTGGGTCTTTGCCATCTTCGCCTTTGCTACGTGCGGCAGCTACACCGGAGAGCTTCGGCTGAGCGTGGAGTGTGCCAACAAGACGGAGAGTGCCCTCAACATCGAAGTCGAATTTGAGTACCCATTCAGGCTGCACCAAGTGTACTTTGATGCACCCTCCTGCGTTAAAGGGGGCACTACCAAGATCTTCCTAGTTGGTGACTACTCCTCCTCGGGTGAATTCTTTGTCACCGTGGCTGTGTTTGCCTTCCTCTACTCCATGGGGGCCCTGGCCACCTACATCTTCCTGCAGAACAAGTACCGAGAGAACAACAAAGGGCCAATGATGGACTTCCTGGCCACAGCAGTGTTCGCTTTCATGTGGCTAGTTAGCTCATCCGCCTGGGCCAAAGGCCTGTCCGATGTGAAGATGGCCACTGACCCAGAGAACATTATCAAGGAGATGCCTATGTGCCGCCAGACAGGAAACACATGCAAGGAACTGAGGGACCCTGT

Numéro d'accès Ensembl | souris

ENSMUSG00000031144

Numéro d'accès NCBI

NM_009305

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... SYP(20977) , Syp(20977)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Toru Mitsumori et al.
Experimental hematology, 42(9), 783-792 (2014-05-28)
The hypoxic microenvironment of the bone marrow, known as the hypoxic niche, supports hematopoietic stem cell quiescence and maintains long-term repopulation activity. Hypoxia also affects the expansion of progenitor cells and enhances erythropoiesis and megakaryopoiesis. In contrast to the known
Hsueh-Chun Wang et al.
BMC cancer, 14, 442-442 (2014-06-17)
Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet
Rong-Ping Zhou et al.
Molecular medicine reports, 11(6), 4489-4495 (2015-01-31)
Chlorogenic acid (CGA) exhibits various biological properties, including the inhibition of oxidation, obesity, apoptosis and tumorigenesis. CGA is also able to promote cell survival and proliferation. The aim of the present study was to determine the effects and underlying molecular
K S Siveen et al.
British journal of cancer, 111(7), 1327-1337 (2014-08-08)
Constitutive activation of signal transducer and activator of transcription signalling 3 (STAT3) has been linked with survival, proliferation and angiogenesis in a wide variety of malignancies including hepatocellular carcinoma (HCC). We evaluated the effect of lupeol on STAT3 signalling cascade

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique