Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU025021

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ccrk

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCCTAGGAGCACCTCTTTCTGATTTGCCTCCATGGCCTCCCCACGGCTATATATACCACACCTGGTCCTGCTCCTTAGTGTGCTTGAGGGCTGGGCTCTGGGAGGCAGAACCGTGAGATGTTCATCCCAGCAGAGAAAGAGACTCACGTCCTACAGACAAAGCCTCCAGAAACTGCTAGCTGTGTCCTTCTCCAGGGCCACCCCTCAGTGGTGCCACCCGGCCTTAGAGATGATTGTCAGGCTCTGTCCCCTCTTCAAGGACATTGGTACTACAGCACCACCTGGTGGAAGCACAGAGTATAAGCTGTCTTCATACCGGGGACACAGCTGGGAAGTCAGACATGTTTTAGTTTTGGTTCCACTGGGTCAGGATTTGAGGTTCATATAAAAGCCCTGGGTGTTTCTGTCTAATTGCACCTTGTCTGTTGCTGTTAGGGAAAGGACAATGGTGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hai Feng et al.
Journal of hepatology, 62(5), 1100-1111 (2014-12-17)
Aberrant chromatin modification is a key feature of hepatocellular carcinoma (HCC), which is characterized by strong sexual dimorphism. Both enhancer of zeste homolog 2 (EZH2) and cell cycle-related kinase (CCRK) contribute to hepatocarcinogenesis, yet whether the two oncogenic factors have
Zhuo Yu et al.
Gut, 63(11), 1793-1804 (2014-01-21)
Androgen receptor (AR) signalling contributes to male predominance in hepatocellular carcinoma (HCC), which is more pronounced in HBV-endemic areas. Cell cycle-related kinase (CCRK) is essential for AR-induced hepatocarcinogenesis but its molecular function in HBV-associated HCC remains obscure. To determine the
Bin You et al.
Oncotarget, 6(6), 4357-4368 (2015-03-05)
Alterations of the EGFR/ERK and Hippo/YAP pathway have been found in non-small cell lung cancer (NSCLC). Herein, we show that ERK1 and ERK2 have an effect on the Hippo/YAP pathway in human NSCLC cells. Firstly, inhibition of ERK1/2 by siRNA

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique