Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EMU013351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fgfr4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAAACACGTCGTCATCAACGGCAGCAGCTTCGGCGCCGACGGTTTCCCCTACGTACAAGTCCTGAAGACAACAGACATCAATATCTCGGAGGTACAGGTCTTGTATCTGAGGAACGTGTCCGCTGAGGATGCAGGAGAGTATACCTGTCTGGCGGGCAACTCCATCGGCCTTTCCTACCAGTCAGCGTGGCTCACGGTGCTGCCAGAGGAAGACCTCACGTGGACAACAGCAACCCCTGAGGCCAGATACACAGATATCATCCTGTATGTATCAGGCTCACTGGTTCTGCTTGTGCTCCTGCTGCTGGCCGGGGTGTATCATCGGCAAGTCATCCGTGGCCACTACTCTCGCCAGCCTGTCACTATACAAAAGCTGTCCCGTTTCCCTTTGGCCCGACAGTTCTCTTTGGAGTCGAGGTCCTCTG

Numéro d'accès Ensembl | souris

ENSMUSG00000005320

Numéro d'accès NCBI

NM_008011

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... FGFR4(14186) , Fgfr4(14186)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Susagna Padrissa-Altés et al.
Gut, 64(9), 1444-1453 (2014-11-25)
Fibroblast growth factors (Fgfs) are key orchestrators of development, and a role of Fgfs in tissue repair is emerging. Here we studied the consequences of inducible loss of Fgf receptor (Fgfr) 4, the major Fgf receptor (Fgfr) on hepatocytes, alone
Jing Yang et al.
Cell cycle (Georgetown, Tex.), 14(20), 3318-3330 (2015-09-18)
Fibroblast growth factors (FGF1, FGF2 and FGF4) and fibroblast growth factor receptors (FGFR1, FGFR2, FGFR3 and FGFR4) have been reported to be expressed in preimplantation embryos and be required for their development. However, the functions of these molecules in trophectoderm
Shuxin Han et al.
Nature communications, 6, 7231-7231 (2015-06-05)
Circadian control of nutrient availability is critical to efficiently meet the energetic demands of an organism. Production of bile acids (BAs), which facilitate digestion and absorption of nutrients, is a major regulator of this process. Here we identify a KLF15-Fgf15

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique