Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU140681

Sigma-Aldrich

MISSION® esiRNA

targeting human KHDRBS1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCAAATATGCCCACTTGAATATGGATCTGCATGTCTTCATTGAAGTCTTTGGACCCCCATGTGAGGCTTATGCTCTTATGGCCCATGCCATGGAGGAAGTCAAGAAATTTCTAGTACCGGATATGATGGATGATATCTGTCAGGAGCAATTTCTAGAGCTGTCCTACTTGAATGGAGTACCTGAACCCTCTCGTGGACGTGGGGTGCCAGTGAGAGGCCGGGGAGCTGCACCTCCTCCACCACCTGTTCCCAGGGGCCGTGGTGTTGGACCACCTCGGGGGGCTTTGGTACGTGGTACACCAGTAAGGGGAGCCATCACCAGAGGTGCCACTGTGACTCGAGGCGTGCCACCCCCACCTACTGTGAGGGGTGCTCCAGCACCAAGAGCACGGACAGCGGGCATCCAGAGGATACCTTTGCCTCCACCTCC

Numéro d'accès Ensembl | humain

ENSG00000121774

Numéro d'accès NCBI

NM_006559

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KHDRBS1(10657) , KHDRBS1(10657)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Shasha Tao et al.
Environmental toxicology, 34(5), 594-609 (2019-01-31)
Fine particulate matter is a well-known air pollutant threatening public health. Studies have confirmed long-term exposure to the particles could decrease the pulmonary function, induce asthma exacerbation, and chronic obstructive pulmonary disease, as well as increase the incidence and mortality
Teresa Vilariño-García et al.
Endocrine connections, 9(6), 479-488 (2020-05-07)
Polycystic ovary syndrome (PCOS) is a complex metabolic disorder associated with ovulatory dysfunction, hyperandrogenism, obesity, and insulin resistance, that leads to subfertility. Sam68 is an RNA-binding protein with signaling functions that is ubiquitously expressed, including gonads. Sam68 is recruited to
Hua Zhang et al.
Journal of virology, 89(19), 10031-10043 (2015-07-24)
Enterovirus 71 (EV71) recruits various cellular factors to assist in the replication and translation of its genome. Identification of the host factors involved in the EV71 life cycle not only will enable a better understanding of the infection mechanism but

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique