Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU131511

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXA10

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGCAATTCCAAAGGTGAAAACGCAGCCAACTGGCTCACGGCAAAGAGTGGTCGGAAGAAGCGCTGCCCCTACACGAAGCACCAGACACTGGAGCTGGAGAAGGAGTTTCTGTTCAATATGTACCTTACTCGAGAGCGGCGCCTAGAGATTAGCCGCAGCGTCCACCTCACGGACAGACAAGTGAAAATCTGGTTTCAGAACCGCAGGATGAAACTGAAGAAAATGAATCGAGAAAACCGGATCCGGGAGCTCACAGCCAACTTTAATTTTTCCTGATGAATCTCCAGGCGACGCGGTTTTTTCACTTCCCGAGCGCTGGTCCCCTCCCTCTGTCTTCAGGCTCTGCCCAGGAACTCGCACCTGTGCTGGAGCCCTGTTCCTCCCTCCCACACTCGCCATCTCCTGGGCCGTTACATCTGTGCAGGGCTGGTTTGTTCTGACTTTTTGTTTCTTTGTGTTTGCTTGGTGC

Numéro d'accès Ensembl | humain

ENSG00000153807

Numéro d'accès NCBI

NM_018951

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... HOXA10(3206) , HOXA10(3206)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Li Wang et al.
Reproductive sciences (Thousand Oaks, Calif.), 26(6), 839-846 (2018-12-14)
Endometrial receptivity is a critical factor for embryo implantation. A decrease in endometrial homeobox A10 (HOXA10) expression is associated with hypermethylation of its promoter and lower endometrial receptivity in animals and humans. 5-Aza-2'-deoxycytidine (AZA) is a DNA methyltransferase inhibitor. However
Xian-Ping Cui et al.
Digestive diseases and sciences, 59(7), 1442-1451 (2014-01-28)
HOXA10 is closely related to tumor progression in many human cancers. However, the role of HOXA10 in pancreatic cancer remains unclear. The aim of this study was to determine the involvement of HOXA10 in pancreatic cancer cell invasion and migration.
L Zhang et al.
Reproduction in domestic animals = Zuchthygiene, 52(6), 1081-1092 (2017-08-02)
Proper HOXA10 expression was essential for endometrial receptivity what was crucial for successful embryo implantation in mammalian. This study confirmed that miR-182 regulated the expression levels of HOXA10 by binding to its 3' UTR, selectively downregulated HOXA10 in goat endometrial
Zhi Long et al.
Endocrine-related cancer, 26(3), 279-292 (2019-01-23)
Homeobox A10 (HOXA10) is an important transcription factor that regulates the development of the prostate gland. However, it remains unknown whether it modulates prostate cancer (PCa) progression into castrate-resistant stages. In this study, we have applied RNA in situ hybridization

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique