Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU129311

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM10

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCGAACTCTGCCATTTCACTCTGTCATTTATCATGAAGATGATATTAACTATCCCCATAAATACGGTCCTCAGGGGGGCTGTGCAGATCATTCAGTATTTGAAAGAATGAGGAAATACCAGATGACTGGTGTAGAGGAAGTAACACAGATACCTCAAGAAGAACATGCTGCTAATGGTCCAGAACTTCTGAGGAAAAAACGTACAACTTCAGCTGAAAAAAATACTTGTCAGCTTTATATTCAGACTGATCATTTGTTCTTTAAATATTACGGAACACGAGAAGCTGTGATTGCCCAGATATCCAGTCATGTTAAAGCGATTGATACAATTTACCAGACCACAGACTTCTCCGGAATCCGTAACATCAGTTTCATGGTGAAACGCATAAGAATCAATACAACTGCTGATGAGAAGGACCCTACAAATCCTTTCCGTTTCCC

Numéro d'accès Ensembl | humain

ENSG00000137845

Numéro d'accès NCBI

NM_001110

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ADAM10(102) , ADAM10(102)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zhuo-peng Ye et al.
PloS one, 9(8), e105350-e105350 (2014-08-16)
CD8+ T cells play an important role in the anti-tumor activities of the body. The dysfunction of CD8+ T cells in glioma is unclear. This study aims to elucidate the glioma cell-derived ADAM10 (A Disintegrin and metalloproteinase domain-containing protein 10)
Zikang Xie et al.
Environmental toxicology, 35(8), 867-878 (2020-03-22)
MiR-20a has been reported as a key regulator to pro-inflammatory factor release in fibroblast-like synoviocytes (FLS), which caused rheumatoid arthritis (RA). However, the molecular mechanism of miR-20a in RA remains to be further elucidated. This study aimed to investigate the
Jun Lu et al.
Cancer management and research, 12, 9577-9587 (2020-10-17)
Non-small cell lung cancer (NSCLC) remains the most commonly diagnosed malignancy and the leading cause of cancer death worldwide. Circular RNAs (circRNAs) have been demonstrated to play critical roles in human carcinogenesis, including NSCLC. However, it is still unclear whether
Chuanjin Ding et al.
Oncology reports, 38(2), 866-874 (2017-06-29)
The aim of this study was to determine the effect of A disintegrin and metalloprotease 10 (ADAM10) protein expression on the progression, migration and prognosis of hypopharyngeal squamous cell carcinoma (HSCC). Immunohistochemistry and western blot analysis were performed to detect ADAM10
Jessica Pruessmeyer et al.
Blood, 123(26), 4077-4088 (2014-05-17)
Inflammation is a key process in various diseases, characterized by leukocyte recruitment to the inflammatory site. This study investigates the role of a disintegrin and a metalloproteinase (ADAM) 10 and ADAM17 for leukocyte migration in vitro and in a murine
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique