Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU113911

Sigma-Aldrich

MISSION® esiRNA

targeting human XRCC6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AACATGTCAGGGTGGGAGTCATATTACAAAACCGAGGGCGATGAAGAAGCAGAGGAAGAACAAGAAGAGAACCTTGAAGCAAGTGGAGACTATAAATATTCAGGAAGAGATAGTTTGATTTTTTTGGTTGATGCCTCCAAGGCTATGTTTGAATCTCAGAGTGAAGATGAGTTGACACCTTTTGACATGAGCATCCAGTGTATCCAAAGTGTGTACATCAGTAAGATCATAAGCAGTGATCGAGATCTCTTGGCTGTGGTGTTCTATGGTACCGAGAAAGACAAAAATTCAGTGAATTTTAAAAATATTTACGTCTTACAGGAGCTGGATAATCCAGGTGCAAAACGAATTCTAGAGCTTGACCAGTTTAAGGGGCAGCAGGGACAAAAACGTTTCCAAGACATGATGGGC

Numéro d'accès Ensembl | humain

ENSG00000196419

Numéro d'accès NCBI

NM_001469

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... XRCC6(2547) , XRCC6(2547)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ke Luo et al.
OncoTargets and therapy, 11, 7559-7567 (2018-11-23)
As one of the most prevalent malignancies, glioma is characterized by poor prognosis and high mortality rate. Glioma patients may show completely distinct clinical outcomes due to their different molecular patterns. Sirtuin 3 (Sirt3) participates in aging, stress resistance, and
Jiali Ma et al.
Biochemical and biophysical research communications, 484(4), 746-752 (2017-02-06)
The current study focused on the role of Ku70, a DNA-dependent protein kinase (DNA-PK) complex protein, in pancreatic cancer cell resistance to gemcitabine. In both established cell lines (Mia-PaCa-2 and PANC-1) and primary human pancreatic cancer cells, shRNA/siRNA-mediated knockdown of
Manila Hada et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(10), 13903-13914 (2016-08-05)
The first known function of Ku70 is as a DNA repair factor in the nucleus. Using neuronal neuroblastoma cells as a model, we have established that cytosolic Ku70 binds to the pro-apoptotic protein Bax in the cytosol and blocks Bax's
Raghavendra A Shamanna et al.
Nature communications, 7, 13785-13785 (2016-12-07)
Werner syndrome (WS) is an accelerated ageing disorder with genomic instability caused by WRN protein deficiency. Many features seen in WS can be explained by the diverse functions of WRN in DNA metabolism. However, the origin of the large genomic
Kristen E Mengwasser et al.
Molecular cell, 73(5), 885-899 (2019-01-29)
BRCA1 or BRCA2 inactivation drives breast and ovarian cancer but also creates vulnerability to poly(ADP-ribose) polymerase (PARP) inhibitors. To search for additional targets whose inhibition is synthetically lethal in BRCA2-deficient backgrounds, we screened two pairs of BRCA2 isogenic cell lines
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique