Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU113241

Sigma-Aldrich

MISSION® esiRNA

targeting human G3BP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCCTCAGGAGGAGTCTGAAGAAGAAGTAGAGGAACCTGAAGAAAGACAGCAAACACCTGAGGTGGTACCTGATGATTCTGGAACTTTCTATGATCAGGCAGTTGTCAGTAATGACATGGAAGAACATTTAGAGGAGCCTGTTGCTGAACCAGAGCCTGATCCTGAACCAGAACCAGAACAAGAACCTGTATCTGAAATCCAAGAGGAAAAGCCTGAGCCAGTATTAGAAGAAACTGCCCCTGAGGATGCTCAGAAGAGTTCTTCTCCAGCACCTGCAGACATAGCTCAGACAGTACAGGAAGACTTGAGGACATTTTCTTGGGCATCTGTGACCAGTAAGAATCTTCCACCCAGTGGAGCTGTTCCAGTTACTGGGATACCACCTCATGTTGTTAAAGTACCAGCTTCACAGCCC

Numéro d'accès Ensembl | humain

ENSG00000145907

Numéro d'accès NCBI

NM_005754

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... G3BP1(10146) , G3BP1(10146)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ning Dou et al.
American journal of cancer research, 6(11), 2641-2650 (2016-12-03)
RasGAP SH3-domain-Binding Protein 1 (G3BP1) has been implicated in cell growth, migration, and metastasis of some cancers, yet its function in hepatocellular carcinoma (HCC) remains to be explored. In the present study, we reported that G3BP1 was upregulated in HCC
Amr Omer et al.
EMBO reports, 19(5) (2018-03-30)
Cellular senescence is a physiological response by which an organism halts the proliferation of potentially harmful and damaged cells. However, the accumulation of senescent cells over time can become deleterious leading to diseases and physiological decline. Our data reveal a
Amr Omer et al.
Nature communications, 11(1), 4979-4979 (2020-10-07)
Cellular senescence is a known driver of carcinogenesis and age-related diseases, yet senescence is required for various physiological processes. However, the mechanisms and factors that control the negative effects of senescence while retaining its benefits are still elusive. Here, we
Allison B Herman et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(10), 2014-2027 (2019-08-30)
Stress granules (SGs) are dynamic cytoplasmic aggregates containing mRNA, RNA-binding proteins, and translation factors that form in response to cellular stress. SGs have been shown to contribute to the pathogenesis of several human diseases, but their role in vascular diseases
David Pla-Martín et al.
The EMBO journal, 39(9), e102731-e102731 (2020-03-10)
Mitochondria house anabolic and catabolic processes that must be balanced and adjusted to meet cellular demands. The RNA-binding protein CLUH (clustered mitochondria homolog) binds mRNAs of nuclear-encoded mitochondrial proteins and is highly expressed in the liver, where it regulates metabolic

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique