Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU100071

Sigma-Aldrich

MISSION® esiRNA

targeting human NUAK1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCATCACCACAAGCACAACTTGAAGCACCGCTACGAGCTGCAGGAGACCCTGGGCAAAGGCACCTACGGCAAAGTCAAGCGGGCCACCGAGAGGTTTTCTGGCCGAGTGGTTGCTATAAAATCCATTCGTAAGGACAAAATTAAGGATGAACAAGACATGGTTCACATCAGACGAGAGATTGAGATCATGTCATCTCTCAACCATCCTCATATCATCAGTATTTATGAAGTGTTTGAGAACAAAGATAAGATTGTGATCATCATGGAATATGCCAGCAAAGGGGAGCTGTACGATTACATCAGTGAGCGGCG

Numéro d'accès Ensembl | humain

ENSG00000074590

Numéro d'accès NCBI

NM_014840

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... NUAK1(9891) , NUAK1(9891)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Minghui Li et al.
American journal of translational research, 9(4), 1708-1719 (2017-05-05)
Lung cancer incidence and mortality rates are amongst the highest of all malignant tumors worldwide. ARK5 is a member of the human AMP-activated protein kinase (AMPK) family which is implicated in tumor survival and progression. The current study was designed
Ji Kui Peng et al.
Oncology letters, 15(3), 3639-3645 (2018-02-23)
Hypoxia is a common characteristic of solid tumors. Previous studies have reported that the tumor invasion-associated factor, AMPK-related protein kinase 5 (ARK5), is associated with a poor prognosis in colon cancer. However, whether or not ARK5 is involved in hypoxia
Emilia Escalona et al.
Frontiers in oncology, 10, 1123-1123 (2020-08-06)
NUAK1 is an AMPK-related kinase located in the cytosol and the nucleus, whose expression associates with tumor malignancy and poor patient prognosis in several cancers. Accordingly, NUAK1 was associated with metastasis because it promotes cell migration and invasion in different
Martin Golkowski et al.
Cell systems, 11(2), 196-207 (2020-08-07)
Hepatocellular carcinoma (HCC) is a complex and deadly disease lacking druggable genetic mutations. The limited efficacy of systemic treatments for advanced HCC implies that predictive biomarkers and drug targets are urgently needed. Most HCC drugs target protein kinases, indicating that
Giacomo Cossa et al.
Molecular cell, 77(6), 1322-1339 (2020-02-02)
Deregulated expression of MYC induces a dependence on the NUAK1 kinase, but the molecular mechanisms underlying this dependence have not been fully clarified. Here, we show that NUAK1 is a predominantly nuclear protein that associates with a network of nuclear

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique