Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU097101

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTCTCGGACAACATCTTCTCTCGCCAGTCAGACGTCTGGAGCTTCGGGGTCGTCCTGTACGAGCTCTTCACCTACTGCGACAAAAGCTGCAGCCCCTCGGCCGAGTTCCTGCGGATGATGGGATGTGAGCGGGATGTCCCCGCCCTCTGCCGCCTCTTGGAACTGCTGGAGGAGGGCCAGAGGCTGCCGGCGCCTCCTGCCTGCCCTGCTGAGGTGAGTTGCTACAGTGGCTGGAGAGACGACATCTGCTCCATGGGCTGGTGGCCGACAGTAATCTCACGCTGGGACCTGGCCTGCAGCCCCTGCCCCAGACCTCTCACCATCACC

Numéro d'accès Ensembl | humain

ENSG00000105639

Numéro d'accès NCBI

NM_000215

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... JAK3(3718)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Longfei Pan et al.
Experimental biology and medicine (Maywood, N.J.), 245(15), 1395-1403 (2020-07-16)
Accumulating evidence suggests that vascular remodeling due to immoderate proliferation and migration of SMCs is a common process occurring in APE. In this work, we tried to find a breakthrough in the pathological mechanism to alleviate the prognosis of APE
Jung Seok Kim et al.
International journal of nanomedicine, 13, 4817-4830 (2018-09-15)
Efficient target-specific siRNA delivery has always been a primary concern in the field of siRNA clinical application. In this study, four different types of anti-epidermal growth factor receptor (EGFR) antibody-conjugated immunonanoparticles were prepared and tested for cancer cell-targeted therapeutic siRNA
Nina A Sibbesen et al.
Oncotarget, 6(24), 20555-20569 (2015-08-06)
Aberrant activation of Janus kinase-3 (Jak3) and its key down-stream effectors, Signal Transducer and Activator of Transcription-3 (STAT3) and STAT5, is a key feature of malignant transformation in cutaneous T-cell lymphoma (CTCL). However, it remains only partially understood how Jak3/STAT

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique