Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU084371

Sigma-Aldrich

MISSION® esiRNA

targeting human SON

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCTGAGGAACACCTGAAAGGTGACTTTTACGAAAGTGAACATGGTATAAATATAGACCTTAATATAAATAATCATTTAATTGCTAAAGAGATGGAACATAATACAGTGTGTGCTGCTGGTACTAGTCCTGTTGGGGAAATTGGTGAAGAGAAAATTTTGCCCACCAGTGAGACTAAACAGCGCACAGTATTGGATACCTACCCTGGTGTTAGTGAAGCTGATGCAGGAGAAACTCTATCTTCTACTGGTCCTTTTGCTCTGGAACCTGATGCAACAGGAACTAGTAAGGGTATTGAATTTACCACAGCATCTACTCTCAGTTTAGTTAATAAATATGATGTTGATTTATCTTTAACTACTCAAGATACTGAACATGACATGGTAATTTCCACCAGTCCTAGTGGTGGTAGTGAAGCTGACATTGAAGGGCCTTTG

Numéro d'accès Ensembl | humain

ENSG00000159140

Numéro d'accès NCBI

NM_138927

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... SON(6651) , SON(6651)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Vishnu Priya Battini et al.
International journal of molecular sciences, 16(3), 5886-5899 (2015-03-18)
Pre-mRNA splicing requires proper splice site selection mediated by many factors including snRNPs and serine-arginine rich (SR) splicing factors. Our lab previously reported that the SR-like protein SON maintains organization of pre-mRNA splicing factors in nuclear speckles as well as
Hyehyeon Lee et al.
Molecules and cells, 42(1), 67-78 (2018-12-07)
Methylation of HBV cccDNA has been detected in vivo and in vitro; however, the mechanism and its effects on HBV replication remain unclear. HBx derived from a 1.2-mer HBV replicon upregulated protein levels and enzyme activities of DNA methyltransferase 1
İbrahim Avşar Ilik et al.
eLife, 9 (2020-10-24)
Nuclear speckles (NS) are among the most prominent biomolecular condensates. Despite their prevalence, research on the function of NS is virtually restricted to colocalization analyses, since an organizing core, without which NS cannot form, remains unidentified. The monoclonal antibody SC35

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique