Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU076641

Sigma-Aldrich

MISSION® esiRNA

targeting human JARID2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCCTTTTGCAATCAGCATTTGGATCTCAGAATGAGCAAGGAAAGACCCAAGAGGAATATCATTCAGAAGAAATACGATGACAGTGATGGGATTCCGTGGTCAGAAGAACGGGTGGTACGTAAAGTCCTTTATTTGTCTCTGAAGGAGTTCAAGAATTCCCAGAAGAGGCAGCATGCGGAAGGCATTGCTGGGAGCCTGAAAACTGTGAATGGGCTCCTTGGTAATGACCAGTCTAAGGGATTAGGACCAGCATCAGAACAGTCAGAGAATGAAAAGGACGATGCATCCCAAGTGTCCTCCACTAGCAACGATGTTAGTTCTTCAGATTTTGAAGAAGGGCCGTCGAGGAAAAGGCCCAGGCTGCAAGCACAAAGGAAGTTTGCTCAGTCTCAGCCGAATAGTCCCAGCACAACTCCAGTAAAGATAGTGGAGCCATTGCTACCC

Numéro d'accès Ensembl | humain

ENSG00000008083

Numéro d'accès NCBI

NM_004973

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... JARID2(3720) , JARID2(3720)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Diaa Al-Raawi et al.
The EMBO journal, 38(3) (2018-12-24)
Polycomb repressive complex-2 (PRC2) is a group of proteins that play an important role during development and in cell differentiation. PRC2 is a histone-modifying complex that catalyses methylation of lysine 27 of histone H3 (H3K27me3) at differentiation genes leading to
Dandan Liang et al.
International journal of cardiology, 201, 38-48 (2015-08-25)
In mammals, the heart grows by hypertrophy but not proliferation of cardiomyocytes after birth. The paucity of cardiomyocyte proliferation limits cardiac regeneration in a variety of heart diseases. To explore the efficient strategies that drive cardiomyocyte proliferation, we employed in
Chang-Liang Su et al.
International journal of hematology, 102(1), 76-85 (2015-05-06)
It has recently been shown that JARID2 contributes to the malignant character of solid tumors, such as epithelial-mesenchymal transition in lung and colon cancer cell lines, but its role in leukemia progression is unexplored. In this study, we explored the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique