Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU061141

Sigma-Aldrich

MISSION® esiRNA

targeting human KALRN

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCAAGGATCTGGGCATTGTGGTGGAGGGCTTCATGAAGAGAATAGAAGAAAAGGGTGTCCCTGAGGATATGCGAGGAAAGGACAAAATCGTGTTTGGAAATATTCATCAGATTTATGACTGGCATAAGGATTTTTTCCTGGCGGAACTGGAAAAGTGTATCCAGGAGCAAGACAGATTGGCACAGCTCTTTATTAAGCACGAGCGGAAGCTGCACATCTACGTGTGGTATTGTCAGAATAAGCCGCGCTCAGAGTACATCGTTGCTGAGTATGACGCCTACTTTGAGGAGGTAAAACAGGAGATAAATCAGAGGCTGACACTGAGTGACTTCCTCATCAAGCCCATTCAGAGAATAACAAAATACCAGTTGCTCCTCAAGGACTTCCTGAGATACAGTGAGAAGGCTGGTTTGGAGTG

Numéro d'accès Ensembl | humain

ENSG00000160145

Numéro d'accès NCBI

NM_001024660

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KALRN(8997) , KALRN(8997)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Caixia Zang et al.
Molecular neurobiology, 56(4), 2870-2880 (2018-08-02)
Neuroinflammation has been implicated as an important factor in the neurodegenerative diseases, and multiple candidates with anti-inflammatory effects have been shown to be beneficial for the treatment of neurodegenerative diseases. Our previous study demonstrated that a novel synthetic phloroglucinol derivative
Mengyuan Li et al.
Journal for immunotherapy of cancer, 8(2) (2020-10-11)
kalirin RhoGEF kinase (KALRN) is mutated in a wide range of cancers. Nevertheless, the association between KALRN mutations and the pathogenesis of cancer remains unexplored. Identification of biomarkers for cancer immunotherapy response is crucial because immunotherapies only show beneficial effects

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique