Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU054851

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC6

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCATGGAAATTCTGGACACCCGCTGGTCCTCAGCTACATCGACCTGTCAGCCTGGTGTTACTACTGTCAGGCCTATGTCCACCACCAGGCTCTCCTAGATGTGAAGAACATCGCCCACCAGAACAAGTTTGGGGAGGATATGCCCCACCCACACTAAGCCCCAGAATACGGTCCCTCTTCACCTTCTGAGGCCCACGATAGACCAGCTGTAGCTCATTCCAGCCTGTACCTTGGATGAGGGGTAGCCTCCCACTGCATCCCATCCTGAATATCCTTTGCAACTCCCCAAGAGTGCTTATTTAAGTGTTAATACTTTTAAGAGAACTGCGACGATTAATTGTGGATCTCCCCCTGCCCATTGCCTGCTTGAGGGGCACCACTACTCCAGCCCAGAAGGAAA

Numéro d'accès Ensembl | humain

ENSG00000094631

Numéro d'accès NCBI

NM_006044

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... HDAC6(10013) , HDAC6(10013)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mo Cheng et al.
European journal of pharmacology, 840, 1-8 (2018-10-03)
Emerging evidence shows that cytokines such as interleukins (ILs) are involved in the progression and chemoresistance of multiple tumors, including osteosarcoma (OS). Our present study established the doxorubicin (Dox) resistant human OS MG-63 and HOS cells and named them MG-63/Dox
Lei Yang et al.
Journal of molecular and cellular cardiology, 127, 143-153 (2018-12-26)
Extracellular pH strongly affects cellular metabolism and function. An acidic environment induced under pathological conditions leads to cardiomyocyte injury and dysfunction, but the underlying mechanisms are still poorly understood. Autophagy has been reported as a cytoprotective mechanism that maintains cellular
Hyeanjeong Jeong et al.
International journal of molecular sciences, 20(17) (2019-09-05)
Epigenetic remodeling via histone acetylation has become a popular therapeutic strategy to treat Alzheimer's disease (AD). In particular, histone deacetylase (HDAC) inhibitors including M344 and SAHA have been elucidated to be new drug candidates for AD, improving cognitive abilities impaired
Shigeki Saito et al.
PloS one, 12(10), e0186615-e0186615 (2017-10-19)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive and fatal disease. Histone deacetylase 6 (HDAC6) alters function and fate of various proteins via deacetylation of lysine residues, and is implicated in TGF-β1-induced EMT (epithelial-mesenchymal transition). However, the role of HDAC6
Liuqing Xu et al.
Oncotarget, 8(51), 88730-88750 (2017-11-29)
The role of histone deacetylase 6 (HDAC6) in peritoneal fibrosis remains unknown. In this study, we examined the effect of HDAC6 inhibition on the epithelial-mesenchymal transition (EMT) of peritoneal mesothelial cells and development of peritoneal fibrosis. Treatment with tubastatin A
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique