Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Documents

EHU050421

Sigma-Aldrich

MISSION® esiRNA

targeting human DPYSL2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ACGAGCGATCGTCTTCTGATCAAAGGAGGTAAAATTGTTAATGATGACCAGTCGTTCTATGCAGACATATACATGGAAGATGGGTTGATCAAGCAAATAGGAGAAAATCTGATTGTGCCAGGAGGAGTGAAGACCATCGAGGCCCACTCCCGGATGGTGATCCCCGGAGGAATTGACGTCCACACTCGTTTCCAGATGCCTGATCAGGGAATGACGTCTGCTGATGATTTCTTCCAAGGAACCAAGGCGGCCCTGGCTGGGGGAACCACTATGATCATTGACCACGTTGTTCCTGAGCCTGGGACAAGCCTGCTCGCTGCCTTTGACCAGTGGAGGGAATGGGCCGACAGCAAGTCCTGCTGTGACTACTCTCTGCATGTGGACATCAGTGAGTGGCATAAGGGCATCCAGGAGGAGATGGAAGCGCTTGTGAAGGATCACGGGGTAAATTCC

Numéro d'accès Ensembl | humain

ENSG00000092964

Numéro d'accès NCBI

NM_001386

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... DPYSL2(1808) , DPYSL2(1808)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hervé Husson et al.
Human molecular genetics, 25(11), 2245-2255 (2016-10-30)
Polycystic kidney diseases (PKDs) comprise a subgroup of ciliopathies characterized by the formation of fluid-filled kidney cysts and progression to end-stage renal disease. A mechanistic understanding of cystogenesis is crucial for the development of viable therapeutic options. Here, we identify
Lokesh Agrawal et al.
Neuropharmacology, 158, 107712-107712 (2019-07-22)
Serotonin (5-HT) homeostasis is critical for the brain development which influences neurogenesis, neuronal migration, and circuit formation. Distinctive distribution patterns of serotonin receptors (5-HTRs) in the brain govern various physiological activities. Amongst the 5-HTRs, serotonin 4 receptor (5-HT4R) is widely
Eun J Na et al.
Frontiers in molecular neuroscience, 10, 288-288 (2017-10-03)
Collapsin response mediator protein (CRMP)-2 and the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway are associated with common physiological functions such as neuronal polarity, axonal outgrowth and synaptic strength, as well as various brain disorders including epilepsy. But
Laura Duciel et al.
Scientific reports, 9(1), 2990-2990 (2019-03-01)
Uveal melanoma (UM) is an aggressive tumor in which approximately 50% of patients develop metastasis. Expression of the PTP4A3 gene, encoding a phosphatase, is predictive of poor patient survival. PTP4A3 expression in UM cells increases their migration in vitro and

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique