Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU043151

Sigma-Aldrich

MISSION® esiRNA

targeting human KPNB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGCATGGACTGTAGGCAGAATTTGTGAGCTGCTTCCTGAAGCTGCCATCAATGATGTCTACTTGGCTCCCCTGCTACAGTGTCTGATTGAGGGTCTCAGTGCTGAACCCAGAGTGGCTTCAAATGTGTGCTGGGCTTTCTCCAGTCTGGCTGAAGCTGCTTATGAAGCTGCAGACGTTGCTGATGATCAGGAAGAACCAGCTACTTACTGCTTATCTTCTTCATTTGAACTCATAGTTCAGAAGCTCCTAGAGACTACAGACAGACCTGATGGACACCAGAACAACCTGAGGAGTTCTGCATATGAATCTCTGATGGAAATTGTGAAAAACAGTGCCAAGGATTGTTATCCTGCTGTCCAGAAAACGACTTTGGTCATCATGGAACGACTGCAACAGGTTCTTCA

Numéro d'accès Ensembl | humain

ENSG00000108424

Numéro d'accès NCBI

NM_002265

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... KPNB1(3837) , KPNB1(3837)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Noboru Sekimoto et al.
Journal of Cancer, 8(19), 4125-4140 (2017-12-01)
Lung cancer is a major cause of death worldwide, with lung adenocarcinoma being the most frequently diagnosed subtype in Japan. Finding the target of an anticancer drug can improve lung adenocarcinoma treatments. Polo-like kinase 1 (PLK1) is an essential mitotic
Michiko Kodama et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(35), E7301-E7310 (2017-08-16)
Epithelial ovarian cancer (EOC) is a deadly cancer, and its prognosis has not been changed significantly during several decades. To seek new therapeutic targets for EOC, we performed an in vivo dropout screen in human tumor xenografts using a pooled
Zhen Wang et al.
Emerging microbes & infections, 9(1), 2030-2045 (2020-09-03)
The interferon-inducible myxovirus resistance B (MxB) protein has been reported to inhibit HIV-1 and herpesviruses by blocking the nuclear import of viral DNA. Here, we report a new antiviral mechanism in which MxB restricts the nuclear import of HIV-1 regulatory
Aihua Dai et al.
Neurochemical research, 40(11), 2177-2187 (2015-08-26)
Kpnb1, also known as Importin β1, is a member of the Karyopherin protein family which plays a important role in nuclear import and export pathways. Its expression has been shown to be responsive to stress, such as heat shock, ethanol

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique