Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU039371

Sigma-Aldrich

MISSION® esiRNA

targeting human FSTL1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGATGGACACTGCAAAGAGAAGAAATCCGTAAGTCCATCTGCCAGCCCAGTTGTTTGCTATCAGTCCAACCGTGATGAGCTCCGACGTCGCATCATCCAGTGGCTGGAAGCTGAGATCATTCCAGATGGCTGGTTCTCTAAAGGCAGCAACTACAGTGAAATCCTAGACAAGTATTTTAAGAACTTTGATAATGGTGATTCTCGCCTGGACTCCAGTGAATTCCTGAAGTTTGTGGAACAGAATGAAACTGCCATCAATATTACAACGTATCCAGACCAGGAGAACAACAAGTTGCTTAGGGGACTCTGTGTTGATGCTCTCATTGAACTGTCTGATGAAAATGCTGATTGGAAACTCAGCTTCCAAGAGTTTCTCAAGTGCCTCAACCCATCTTTCAACCCTCCTGA

Numéro d'accès Ensembl | humain

ENSG00000163430

Numéro d'accès NCBI

NM_007085

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... FSTL1(11167) , FSTL1(11167)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Marco Chi-Chung Lau et al.
Cancer research, 77(21), 5886-5899 (2017-09-09)
Esophageal squamous cell carcinoma (ESCC) has a generally poor prognosis, and molecular markers to improve early detection and predict outcomes are greatly needed. Here, we report that the BMP-binding follistatin-like protein FSTL1 is overexpressed in ESCCs, where it correlates with
Wei Zhang et al.
Scientific reports, 7, 45820-45820 (2017-04-01)
Pulmonary hypertension (PH) remains a life-limiting disease characterized by pulmonary vascular remodelling due to aberrant proliferation and migration of pulmonary artery smooth muscle cells (PASMCs), thus leading to raised pulmonary arterial pressure and right ventricular hypertrophy. Secreted glycoprotein follistatin-like 1
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique