Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EHU033701

Sigma-Aldrich

MISSION® esiRNA

targeting human BNIP3L

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme

Sélectionner une taille de conditionnement

20 μG
303,00 $
50 μG
571,00 $

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.


Sélectionner une taille de conditionnement

Changer de vue
20 μG
303,00 $
50 μG
571,00 $

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

303,00 $


Veuillez contacter notre Service Clients pour connaître la disponibilité de ce produit.

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTACCCATGAACAGCAGCAATGGCAATGATAATGGCAATGGGAAAAATGGGGGGCTGGAACACGTACCATCCTCATCCTCCATCCACAATGGAGACATGGAGAAGATTCTTTTGGATGCACAACATGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGAAGATGGGCAGATCATGTTTGATGTGGAAATGCACACCAGCAGGGACCATAGCTCTCAGTCAGAAGAAGAAGTTGTAGAAGGAGAGAAGGAAGTCGAGGCTTTGAAGAAAAGTGCGGACTGGGTATCAGACTGGTCCAGTAGACCCGAAAACATTCCACCCAAGGAGTTCCACTTCAGACACCCTAAACGTTCTGTGTCTTTAAGCATGAGGAAAAGTGGAGCCATGA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Chen Yan et al.
Cancer letters, 388, 34-42 (2016-12-04)
Cancer stem cells (CSCs) are known to be drug resistant. Mitophagy selectively degrades unnecessary or damaged mitochondria by autophagy during cellular stress. To investigate the potential role of mitophagy in drug resistance in CSCs, we purified CD133
Dan Xu et al.
American journal of physiology. Renal physiology, 316(2), F382-F395 (2018-09-13)
Proteinuria, the most common symptom of renal injury, is an independent factor for renal tubular injury. However, the underlying mechanism remains to be fully elucidated. Mitochondrion is an important target for proteinuria-induced renal tubular cell injury. Insufficient mitophagy exacerbates cell
Sajid Naeem et al.
Toxicology letters, 326, 1-10 (2020-03-07)
Our previous study demonstrated that cadmium (Cd) is an effective inducer of mitophagy, which is mainly mediated by PINK1/Parkin pathway. However, the role of other mitophagy pathways in Cd-induced mitophagy remains elusive. The present study employed HeLa cells, lacking fully
Changfeng Li et al.
Developmental cell, 46(4), 441-455 (2018-08-14)
Pancreatic cancer is an aggressive malignancy with changes in the tumor microenvironment. Here, we demonstrate that PINK1 and PARK2 suppressed pancreatic tumorigenesis through control of mitochondrial iron-dependent immunometabolism. Using mouse models of spontaneous pancreatic cancer, we show that depletion of Pink1 and Park2

Questions

Reviews

No rating value

Active Filters

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique