Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU032851

Sigma-Aldrich

MISSION® esiRNA

targeting human CBL

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATCCTGGCTACATGGCTTTTTTGACGTATGACGAAGTGAAAGCTCGGCTCCAGAAATTCATTCACAAACCTGGCAGTTATATCTTCCGGCTGAGCTGTACTCGTCTGGGTCAGTGGGCTATTGGGTATGTTACTGCTGATGGGAACATTCTCCAGACAATCCCTCACAATAAACCTCTCTTCCAAGCACTGATTGATGGCTTCAGGGAAGGCTTCTATTTGTTTCCTGATGGACGAAATCAGAATCCTGATCTGACTGGCTTATGTGAACCAACTCCCCAAGACCATATCAAAGTGACCCAGGAACAATATGAATTATACTGTGAGATGGGCTCCACATTCCAACTATGTAAAATATGTGCTGAAAATGATAAGGATGTAAAGATTGAGCCCTGTGGACACCTCATGTGCACATCCTGTCTTACATCCTGGCAGGAATCAGAAGGTCAGGGCTGTCCTTTCTGCCGATGTGAAAT

Numéro d'accès Ensembl | humain

ENSG00000110395

Numéro d'accès NCBI

NM_005188

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CBL(867) , CBL(867)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ying Hong et al.
Neurology. Genetics, 6(4), e448-e448 (2020-07-09)
To report a series of patients with cerebral arteriopathy associated with heterozygous variants in the casitas B-lineage lymphoma (CBL) gene and examine the functional role of the identified mutant Cbl protein. We hypothesized that mutated Cbl fails to act as
Shimei Chen et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 132, 110856-110856 (2020-10-31)
The incidence of retinopathy of prematurity (ROP) has increased continuously in recent years. However, the therapeutic effects of current treatments still remain undesired. This study aims to investigate the role of C-CBL in retinal angiogenesis in ROP and its potential
Chia-Hao Chang et al.
Oncotarget, 8(19), 31199-31214 (2017-04-19)
Post-translational mechanisms regulating cell-matrix adhesion turnover during cell locomotion are not fully elucidated. In this study, we uncovered an essential role of Y118 site-specific tyrosine phosphorylation of paxillin, an adapter protein of focal adhesion complexes, in paxillin recruitment to autophagosomes
Chirayu Pandya et al.
Psychoneuroendocrinology, 45, 108-118 (2014-05-23)
Brain derived neurotrophic factor (BDNF) signaling through its receptor TrkB plays a crucial role in neurodevelopment and plasticity. Stress and glucocorticoids have been shown to alter TrkB signaling in neurons, and defects in TrkB expression have been reported in the
Y Gui et al.
Oncogene, 34(46), 5718-5728 (2015-03-03)
Suppressor of cytokine signaling 1 (SOCS1) is considered as a tumor suppressor protein in hepatocellular carcinoma (HCC), but the underlying mechanisms remain unclear. Previously, we have shown that SOCS1-deficient hepatocytes displayed increased responsiveness to hepatocyte growth factor (HGF) due to

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique