Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU025781

Sigma-Aldrich

MISSION® esiRNA

targeting human COPA

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGAGTGGTTCCAAGTTTCCAGTATTCAATATGTCATACAATCCAGCAGAAAATGCAGTCCTGCTTTGTACAAGAGCTAGCAATCTAGAGAATAGTACCTATGACCTGTACACCATCCCTAAAGATGCTGACTCCCAGAATCCTGATGCGCCTGAAGGGAAACGATCCTCAGGCCTGACAGCCGTTTGGGTCGCTCGAAATCGGTTTGCTGTCCTAGATCGGATGCATTCGCTTCTGATCAAGAATCTGAAGAATGAGATCACCAAAAAGGTACAGGTGCCCAACTGTGATGAGATCTTCTATGCTGGCACAGGCAATCTCCTGCTTCGAGATGCGGACTCTATCACACTCTTTGACGTACAGCAGAAGCGGACTCTGGCATCTGTGAAGATTTCTAAAGTGAAATACGTTATCTGGTCAGCAGACATGTCACATGTAGCACTACTAGCCAAACACGCCATTGTGATCTGTAACCGCAAACTGGATGCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xinxin Peng et al.
Cancer cell, 33(5), 817-828 (2018-05-01)
Adenosine (A) to inosine (I) RNA editing introduces many nucleotide changes in cancer transcriptomes. However, due to the complexity of post-transcriptional regulation, the contribution of RNA editing to proteomic diversity in human cancers remains unclear. Here, we performed an integrated
Alice Lepelley et al.
The Journal of experimental medicine, 217(11) (2020-07-30)
Heterozygous missense mutations in coatomer protein subunit α, COPA, cause a syndrome overlapping clinically with type I IFN-mediated disease due to gain-of-function in STING, a key adaptor of IFN signaling. Recently, increased levels of IFN-stimulated genes (ISGs) were described in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique