Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EHU008031

Sigma-Aldrich

MISSION® esiRNA

targeting human EAF2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAAAACAAGAGTTGAAGGAAGCAGTAAAATTCAGTATCGTAAAGAACAACAGCAACAACAAATGTGGAATTCAGCCAGGACTCCCAATCTTGTAAAACATTCTCCATCTGAAGATAAGATGTCCCCAGCATCTCCAATAGATGATATCGAAAGAGAACTGAAGGCAGAAGCTAGTCTAATGGACCAGATGAGTAGTTGTGATAGTTCATCAGATTCCAAAAGTTCATCATCTTCAAGTAGTGAGGATAGTTCTAGTGACTCAGAAGATGAAGATTGCAAATCCTCTACTTCTGATACAGGGAATTGTGTCTCAGGACATCCTACCATGACACAGTACAGGATTCCTGATATAGATGCCAGTCATAATAGATTTCGAGACAACAGTGGCCTTCTGATGAATACTTTAAGAAATGATTTGCAGCTGAGTGAATCAGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wenhuan Guo et al.
The Prostate, 75(9), 976-987 (2015-03-27)
ELL-associated factor 2 (EAF2) is an androgen-regulated tumor suppressor in the prostate. However, the mechanisms underlying tumor suppressive function of EAF2 are still largely unknown. Identification of factors capable of modulating EAF2 function will help elucidate the mechanisms underlying EAF2
Liquan Cai et al.
Biochemical and biophysical research communications, 447(2), 292-298 (2014-04-15)
The tumor suppressor EAF2 is regulated by androgen signaling and associated with prostate cancer. While EAF2 and its partner ELL have been shown to be members of protein complexes involved in RNA polymerase II transcriptional elongation, the biologic roles for

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique