Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU161041

Sigma-Aldrich

MISSION® esiRNA

targeting human GPBAR1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACCTGGAGGCAGGCAAGGGCACAGGCTGGAGCCATGCTGCTCTTCGGGCTGTGCTGGGGGCCCTACGTGGCCACACTGCTCCTCTCAGTCCTGGCCTATGAGCAGCGCCCGCCACTGGGGCCTGGGACACTGTTGTCCCTCCTCTCCCTAGGAAGTGCCAGTGCAGCGGCAGTGCCCGTAGCCATGGGGCTGGGCGATCAGCGCTACACAGCCCCCTGGAGGGCAGCCGCCCAAAGGTGCCTGCAGGGGCTGTGGGGAAGAGCCTCCCGGGACAGTCCCGGCCCCAGCATTGCCTACCACCCAAGCAGCCAAAGCAGTGTCGACCTGGACTTGAACTAAAGGAAGGGCCTCTGCTGACTCCTACCAGAGCATCCGTCCAGCTCAGCCATCCAGCCTGTCTCTACC

Ensembl | human accession no.

ENSG00000179921

NCBI accession no.

NM_001077191

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... GPBAR1(151306) , GPBAR1(151306)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hui Liang et al.
Journal of neuroinflammation, 18(1), 40-40 (2021-02-04)
Nucleotide-binding oligomerization domain-like receptor pyrin domain-containing protein 3 (NLRP3) plays an important role in mediating inflammatory responses during ischemic stroke. Bile acid receptor Takeda-G-protein-receptor-5 (TGR5) has been identified as an important component in regulating brain inflammatory responses. In this study
Ai-Di Li et al.
Experimental cell research, 389(2), 111855-111855 (2020-01-25)
Takeda-G-protein-receptor-5 (TGR5) is a G-protein-coupled receptor (GPCR) activated by bile acids, and mortalin is a multipotent chaperone of the HSP70 family. In the present study, TGR5 was detected by immunohistochemistry (IHC) in extrahepatic cholangiocarcinoma (ECC) specimens, and TGR5 expression in
Yu Chen et al.
International immunopharmacology, 71, 144-154 (2019-03-23)
NLRP3 inflammasome has been reported to be associated with inflammatory bowel disease including colitis due to its potential ability to induce IL-1β secretion. Emerging studies have demonstrated that Genistein, a major isoflavone, has potential anti-inflammatory effects in murine model colitis.
You-Chao Qi et al.
Chinese journal of natural medicines, 18(12), 898-906 (2020-12-29)
Taurochenodeoxycholic acid (TCDCA) is one of the main effective components of bile acid, playing critical roles in apoptosis and immune responses through the TGR5 receptor. In this study, we reveal the interaction between TCDCA and TGR5 receptor in TGR5-knockdown H1299
Haiming Xiao et al.
Pharmacological research, 151, 104559-104559 (2019-11-24)
Our previous studies indicated that the G-protein-coupled bile acid receptor, Gpbar1 (TGR5), inhibits inflammation by inhibiting the NF-κB signalling pathway, eventually attenuating diabetic nephropathy (DN). Gentiopicroside (GPS), the main active secoiridoid glycoside of Gentiana manshurica Kitagawa, has been demonstrated to
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service