Skip to Content
MilliporeSigma
All Photos(1)

Documents

EHU120451

Sigma-Aldrich

MISSION® esiRNA

targeting human RAPGEF3

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTCTTTGAACCACACAGCAAGGCAGGGACCGTGTTGTTCAGCCAGGGGGACAAGGGCACTTCGTGGTACATTATCTGGAAGGGATCTGTCAACGTGGTGACCCATGGCAAGGGGCTGGTGACCACCCTGCATGAGGGAGATGATTTTGGACAGCTGGCTCTGGTGAATGATGCACCCCGGGCAGCCACCATCATCCTGCGAGAAGACAACTGTCATTTCCTGCGTGTGGACAAGCAGGACTTCAACCGTATCATCAAGGATGTGGAGGCAAAGACCATGCGGCTGGAAGAACATGGCAAAGTGGTGCTGGTGCTGGAGAGAGCCTCTCAGGGCGCCGGCCCTTCCCGACCCCCAACCCCAGGCAGGAACCGGTATACAGTGATGTCTGGCACCCCAGAGAAGATCCTAGAGCTTCTGTTGGAGGCCATGGGACCAGATTCCAGTGCTCATGACCCAACAGAGACATTCCTCAGCGACTTCCTC

Ensembl | human accession no.

ENSG00000079337

NCBI accession no.

NM_001098531

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RAPGEF3(10411) , RAPGEF3(10411)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li Liu et al.
Molecular vision, 23, 1-7 (2017-02-18)
Increased inflammatory mediator levels are reported in diabetic retinopathy. We previously reported that β-adrenergic receptor agonists reduced inflammatory mediators in the diabetic retina; however, these agents cannot be given systemically. Here, we investigated whether Epac1 is key to the protective
Jongbo Lee et al.
PLoS biology, 18(12), e3001002-e3001002 (2020-12-29)
Nucleocytoplasmic transport (NCT) defects have been implicated in neurodegenerative diseases such as C9ORF72-associated amyotrophic lateral sclerosis and frontotemporal dementia (C9-ALS/FTD). Here, we identify a neuroprotective pathway of like-Sm protein 12 (LSM12) and exchange protein directly activated by cyclic AMP 1
Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Jolanta Wiejak et al.
Biochimica et biophysica acta. Molecular cell research, 1866(2), 264-276 (2018-11-12)
Exchange protein activated by cyclic AMP (EPAC1) suppresses multiple inflammatory actions in vascular endothelial cells (VECs), partly due to its ability to induce expression of the suppressor of cytokine signalling 3 (SOCS3) gene, the protein product of which inhibits interleukin
Jaspal Garg et al.
Oncotarget, 8(27), 44732-44748 (2017-05-18)
Chronic stress has been associated with the progression of cancer and antagonists for β-adrenoceptors (βAR) are regarded as therapeutic option. As they are also used to treat hemangiomas as well as retinopathy of prematurity, a role of endothelial β2AR in
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service